Polymorphic microsatellites in the human bloodfluke, Schistosoma japonicum, identified using a genomic resource

  • Ning Xiao1Email author,

    Affiliated with

    • Justin Remais2,

      Affiliated with

      • Paul J Brindley3,

        Affiliated with

        • Dongchuan Qiu1,

          Affiliated with

          • Robert Spear4,

            Affiliated with

            • Yang Lei1 and

              Affiliated with

              • David Blair5

                Affiliated with

                Parasites & Vectors20114:13

                DOI: 10.1186/1756-3305-4-13

                Received: 8 December 2010

                Accepted: 7 February 2011

                Published: 7 February 2011

                Abstract

                Re-emergence of schistosomiasis in regions of China where control programs have ceased requires development of molecular-genetic tools to track gene flow and assess genetic diversity of Schistosoma populations. We identified many microsatellite loci in the draft genome of Schistosoma japonicum using defined search criteria and selected a subset for further analysis. From an initial panel of 50 loci, 20 new microsatellites were selected for eventual optimization and application to a panel of worms from endemic areas. All but one of the selected microsatellites contain simple tri-nucleotide repeats. Moderate to high levels of polymorphism were detected. Numbers of alleles ranged from 6 to 14 and observed heterozygosity was always >0.6. The loci reported here will facilitate high resolution population-genetic studies on schistosomes in re-emergent foci.

                Findings

                The Asian bloodfluke, Schistosoma japonicum, causes serious human disease in several parts of eastern Asia, and in particular in China where more than 30 million people living in the tropical and subtropical zones are at risk [1]. On the heels of widespread progress in controlling S. japonicum over the past two decades [2], China is facing the challenges posed by re-emergence of schistosomiasis in localities where control activities have nearly ceased and where apparent elimination had been achieved [2, 3]. In comparison to traditional assessment methods, molecular tools will be increasingly important as China targets regions with low prevalence and low infection intensity for elimination [46] on the path to reducing schistosome infection to less than 1% by 2015 [2]. Such tools will be important for high-resolution monitoring of infections in snails and in mammalian hosts, elucidating transmission networks, and improving the targeting of interventions to achieve final elimination of the disease.

                This important pathogen has already received attention from population geneticists using microsatellites [7, 8]. Most of the loci used had been found by examination of the GenBank accessions for S. japonicum data existing at that time or through testing of primers that amplified microsatellite loci in another bloodfluke, S. mansoni. A near-complete draft genome of S. japonicum has been released by the Chinese Human Genome Center in Shanghai [9] and the raw data are available at http://​lifecenter.​sgst.​cn/​schistosoma/​cn/​schistosomaCnInd​exPage.​do. An earlier study [10] reported 17 loci from this resource. In this study we report on additional loci suitable for research into gene flow in S. japonicum in Sichuan Province. Results of this search are presented here. We searched this resource for microsatellite loci using the following criteria:

                • Repeats should be 2, 3 or 4-mer,

                • The number of tandem repeats should be in the range 10-25,

                • Loci should not include compound repeats,

                • Loci should be flanked by single-copy DNA sequences to which PCR primers could be targeted,

                • Loci should be far apart so as to avoid linkage disequilibrium. In practice, since chromosomal assignment of super-contigs is unknown as yet, loci were selected from different super-contigs,

                • Loci should not be in, or close to, known or predicted coding regions.

                The search was undertaken using the software SciRoKo [11]. Following the above criteria, we identified 72 new loci for which primers were designed and synthesized. For 30 loci showing a single band of the correct size in a preliminary screening using an agarose gel, new forward primers were synthesized to permit M13 tailing [12, 13]. All 30 loci were then used for genotyping of ten adult worms. Loci failing to provide clear signals in the expected size range, or that lacked polymorphism, were not considered further. Finally 20 new loci, plus two from [10], were optimized for PCR and used in the genotyping of 20 individual adult worms. Primer annealing temperatures were designed to be very similar with eventual multiplexing in mind.

                The Sichuan Center for Disease Control and Prevention (SCDC) maintains S. japonicum lifecycles, including S. japonicum from infected snails sourced from Hubei and Anhui Provinces passed through rabbit hosts. For this study, existing samples were obtained from SCDC of adult schistosomes that were derived from a single passage of mixed Hubei and Anhui cercariae through a definitive host. Genomic DNA was extracted from 10 individual male and 10 female worms by incubation in hot sodium hydroxide with pH adjustment using a Tris solution (HotSHOT) [14]. The lysates were used as templates for PCR directly. Each worm was genotyped individually.

                All PCRs were carried out in a 10 μl reaction mixture containing 0.5 μl of template DNA (about 17.5 ng), 0.5 μM of each primer but 0.125 μM of any forward primer with an M13 tail, and 5 μl of 2X GoTaq Green Master Mix (Promega Corporation, WI, USA). For PCR amplification, templates were denatured at 94°C for 5 minutes followed by 30 cycles (94°C 30 seconds, 55°C 45 seconds, 72°C 45 seconds), and then by 8 cycles ( 94°C 30 seconds, 53°C 45 seconds, 72°C 45 seconds), and a final extension at 72°C for 10 minutes. PCR products were separated using an ABI 3130 XL automated DNA sequencer with ABI GS500 LIZ internal size standards. Results were read in GeneMapper 4.0 software (Applied Biosystems).

                Estimates of heterozygosity were made, tests conducted for Hardy-Weinberg equilibrium and linkage disequilibrium, and alleles counted. The software package GenAlEx [15] was used for most data analysis. Micro-Checker [16] was used to identify loci at which null (non-amplifying) alleles might be present. Use of the Bonferroni-adjusted 95% confidence interval indicates that null alleles may occur only at locus SjP9, one of the loci reported by [10].

                Table 1 presents the findings for each locus, including numbers of alleles and observed heterozygosity (H). Observed heterozygosity (Ho) at all loci was high, never below 0.6. A few loci deviated significantly from Hardy Weinberg expectations (Table 1), including SjP9 at which null alleles were suspected. Surprisingly, many pairs of loci were in linkage disequilibrium (data not shown). We consider this to be a consequence of the fact that adult worms were derived from pooled cercariae from infected snails: each snail is likely to yield many sibling/clonal cercariae, resulting in significant linkage disequilibrium (e.g. [10]). The pooling of cercariae from two distinct populations is likely to increase this effect. Previous workers [7] noted a high frequency of linkage disequilibrium in S. japonicum and considered it due to inbreeding and non-random mating.
                Table 1

                Primer sequences and other characteristics for each of 22 microsatellite loci amplified from 20 specimens of Schistosoma japonicum

                Locus name

                Primer sequences (tails removed)

                Repeat unit

                Length of locus in Sj Genome draft (excl tails)

                Length range (PCR product - bp excl tail)

                No. of alleles

                In HWE?

                Ho

                He

                SjP4

                F:ACAAGCTCCAATCGTCTCTGA R:GAATACTGCCGCCCTTGTAA

                TAA

                217

                182-244

                14

                 

                0.789

                0.831

                SjP9

                F:GATGAAACAGATACCCAGCAC R:TGCATGTAAAAATGGCTTGC

                TAA

                283

                239-301

                14

                **

                0.600

                0.915

                SjP18

                F:TCCTTTATCTGGGCTGTGGA R:TTTCAGCAGGATAACATGACG

                TGA

                286

                261-298

                7

                 

                0.684

                0.703

                SjP19

                F:GGTATCTTCGCTTTTTAGCATGG

                R:TCCTAGGGTGTGGTATCAGAG

                ATT

                196

                161-257

                12

                **

                0.737

                0.896

                SjP22

                F:CAAAGCCTAAACGTCATAGACAG R:CAACCACCGATAAGTAGAGTGGA

                TTA

                150

                105-167

                11

                *

                0.850

                0.892

                SjP23

                F:GTACGATATGAGGGAAAGTTCA R:CTCTCCTTCAGACGAATTGAG

                TAA

                219

                192-253

                14

                 

                1.00

                0.933

                SjP26

                F:CAAGGGAACATTGTACATGAAG R:TGGTAAAGGAGAAAGTGAACG

                TAA

                307

                229-312

                7

                 

                0.700

                0.659

                SjP28

                F:TAACGCCTTTTCCCACATTC R:ATAACCACGATGGGAACCAA

                TTA

                242

                232-269

                13

                **

                0.900

                0.926

                SjP32

                F:TGTCACCGAGTCTTCATTAGC R:ACAGTCAGTAGACCTGGATAAAC

                TTA

                175

                142-192

                14

                 

                0.950

                0.929

                SjP34

                F:GGCGACCATACATAAGGAGAAT R:GACCGATTTCTAATGGAGCA

                TAA

                409

                381-430

                13

                *

                0.778

                0.908

                SjP37

                F:TCCTTGACACGAGGTACATGT R:ATTACGTAACAGAAGGCTGGA

                TAT

                290

                240-314

                8

                 

                0.833

                0.714

                SjP39

                F:GACGACTGTTAAGTCCATCTGA R:ATAACCAATCTCCACGAAAGC

                ATT

                239

                223-251

                8

                 

                0.900

                0.871

                SjP42

                F:GCTGCAGCTTCTGTGTAGTAA R:GTCTTGCTCAGATCAGTTCGT

                TAA

                216

                199-234

                9

                 

                0.950

                0.855

                SjP43

                F:ACAATGGCTATTGGTTGAGTAG R:GGAGCATGCGTATATGGAAAA

                TAA

                188

                184-235

                9

                 

                0.750

                0.854

                SjP45

                F:ATAACACCGAATCTGTTCAGC R:TAATCCGGTCAGGATGTATGT

                TAT

                156

                150-244

                13

                 

                0.850

                0.921

                SjP48

                F:TTGTTGGGTAGTGATGGTAGG R:TAGTTCATTCCACCTCTTGGA

                TAA

                246

                251-273

                6

                 

                0.650

                0.795

                SjP54

                F:TTAGGCTTGTTGGTGCTGATA R:AGGTAAAGCAAATCCCATAGC

                GGTA

                437

                373-446

                9

                 

                1.00

                0.712

                SjP58

                F:TCCCAGTACCAATGTAGATGTG R:CTAATAAAGTCGTCAAGGAGCA

                AAT

                227

                439-499

                12

                **

                0.800

                0.921

                SjP60

                F:CGATTCATTCATAGCCTGACT R:GAATCCCATCACAGATTAACG

                TAT

                155

                134-165

                10

                 

                0.900

                0.867

                SjP61

                F:TCATCTTGTCACCAACTAGGC R:GCTTGGAGGAGGCTAAAATAC

                TAT

                188

                158-238

                9

                 

                0.700

                0.679

                SjP63

                F:ACCGCCACTACCACTAACCTCA R:TTGACCTGAAATCTGTCCCTA

                TAA

                390

                333-389

                13

                **

                0.800

                0.904

                SjP88

                F:GCTTTCCAGGCATAAACTTCAC R:TCTCCTAATGATGGGAACAG

                TAA

                408

                380-417

                9

                 

                0.950

                0.887

                Sequences of microsatellites reported here have been deposited in GenBank [AB604199 - AB604218].

                Note that the first two loci are from [10] and are included for comparative purposes.

                The annealing temperature of PCRs for all loci is 55°C

                * P < 0.05 ** P < 0.01 as determined in GenAlEx.

                The loci presented here are likely to be specific for S. japonicum. Blast searches of the draft genome of S. mansoni (http://​www.​sanger.​ac.​uk/​Projects/​S_​mansoni/​) failed to find any matches that would indicate conservation of flanking regions in both species (not shown). Searches of the draft genome of S. japonicum yielded only a single "hit" for each locus.

                The microsatellite loci reported here are, with one exception (SjP54), perfect trinucleotide repeats, making scoring easier than for dinucleotide and/or compound repeats. The diversity of alleles and genotypes present in the populations we sampled demonstrate the utility of these markers for future studies on epidemiology of S. japonicum in eastern Asia. Finally, the obvious genetic diversity within field populations of S. japonicum in China demonstrated by these polymorphic microsatellite loci confirms the recent report of marked genetic diversity in this parasite detected by analysis of the S. japonicum transcriptome and proteome [4].

                Declarations

                Acknowledgements

                The authors wish to thank Kang Junxing, Director of the Sichuan Center for Disease Control and Prevention (Chengdu, People's Republic of China) for his continued support and collaboration. The authors also wish to acknowledge Zhong Bo, Ye Hong, Cui Lina, Chen Lin, Zhang Yi, Meng Xianhong of the Sichuan Center for Disease Control and Prevention for their contribution to the laboratory work. This work was supported in part by the NIH/NSF Ecology of Infectious Disease Program (grant no. 0622743) and the Emory Global Health Institute. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

                Authors’ Affiliations

                (1)
                Institute of Parasitic Diseases, Sichuan Center for Disease Control and Prevention
                (2)
                Department of Environmental Health, Rollins School of Public Health, Emory University
                (3)
                Department of Microbiology, Immunology & Tropical Medicine, George Washington University Medical Center
                (4)
                Department of Environmental Health Sciences, School of Public Health, 50 University Hall, University of California
                (5)
                School of Marine and Tropical Biology, James Cook University

                References

                1. McManus DP, Gray DJ, Li YS, Feng Z, Williams GM, Stewart D, Rey-Ladino J, Ross AG: Schistosomiasis in the People's Republic of China: the era of the Three Gorges Dam. Clin Microbiol Rev. 2010, 23: 442-466. 10.1128/CMR.00044-09.PubMed CentralView ArticlePubMed
                2. Zhou XN, Guo JG, Wu XH, Jiang QW, Zheng J, Dang H, Wang XH, Xu J, Zhu HQ, Wu GL, Li YS, Xu XJ, Chen HG, Wang TP, Zhu NQ, Xia G, Wang LY, Zhang SQ, Lin DD, Chen MG, Hao Y: Epidemiology of schistosomiasis in the People's Republic of China, 2004. Emerg Infect Dis. 2007, 13: 1470-1476.PubMed CentralView ArticlePubMed
                3. Liang S, Yang CH, Zhong B, Qiu DC: Re-emerging schistosomiasis in hilly and mountainous areas of Sichuan, China. Bull World Health Organ. 2006, 84: 139-144. 10.2471/BLT.05.025031.PubMed CentralView ArticlePubMed
                4. Liu F, Lu J, Hu W, Wang SY, Cui SJ, Chi M, Yan Q, Wang XR, Song HD, Xu XN, Wang JJ, Zhang XL, Zhang X, Wang ZQ, Xue CL, Brindley PJ, McManus DP, Feng Z, Chen Z, Han ZG: Comparative transcriptomic and proteomic analyses of the human blood fluke, Schistosoma japonicum. PLoS Pathogens. 2006, 2: e29-10.1371/journal.ppat.0020029.PubMed CentralView ArticlePubMed
                5. Xu J, Rong R, Zhang HQ, Shi CJ, Zhu XQ, Xia CM: Sensitive and rapid detection of Schistosoma japonicum DNA by loop-mediated isothermal amplification (LAMP). Int J Parasitol. 2010, 40: 327-331. 10.1016/j.ijpara.2009.08.010.View ArticlePubMed
                6. Hung YW, Remais J: Quantitative Detection of Schistosoma japonicum Cercariae in Water by Real-Time PCR. PLoS Negl Trop Dis. 2008, 2: e337-10.1371/journal.pntd.0000337.PubMed CentralView ArticlePubMed
                7. Shrivastava J, Qian BZ, McVean G, Webster JP: An insight into the genetic variation of Schistosoma japonicum in mainland China using DNA microsatellite markers. Mol Ecol. 2005, 14: 839-849. 10.1111/j.1365-294X.2005.02443.x.View ArticlePubMed
                8. Shrivastava J, Barker GC, Johansen MV, Zhou XN, Aligui GD, McGarvey ST, Webster JP: Isolation and characterization of polymorphic DNA microsatellite markers from Schistosoma japonicum. Mol Ecol Notes. 2003, 3: 406-408. 10.1046/j.1471-8286.2003.00466.x.View Article
                9. Schistosoma japonicum Genome Sequencing and Functional Analysis Consortium: The Schistosoma japonicum genome reveals features of host-parasite interplay. Nature. 2009, 460: 345-351. 10.1038/nature08140.View Article
                10. Yin M, Hu W, Mo X, Wang SY, Brindley PJ, McManus DP, Davis GM, Feng Z, Blair D: Multiple near-identical genotypes of Schistosoma japonicum can occur in snails and have implications for population-genetic analyses. Int J Parasitol. 2008, 38: 1681-1691. 10.1016/j.ijpara.2008.05.015.PubMed CentralView ArticlePubMed
                11. Kofler R, Schlotterer C, Lelley T: SciRoKo: a new tool for whole genome microsatellite search and investigation. Bioinformatics. 2007, 23: 1683-1685. 10.1093/bioinformatics/btm157.View ArticlePubMed
                12. Schuelke M: An economic method for the fluorescent labeling of PCR fragments. Nature Biotech. 2000, 18: 233-234. 10.1038/72708.View Article
                13. Bandelj D, Jakse J, Javornik B: Amplification of fluorescent-labelled microsatellite markers in olives by a novel, economic method. Acta Agric Slovenica. 2004, 83: 323-329.
                14. Truett E, Mynatt LR, Truett AA, Walker AJ, Warman LM: Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and Tris (HotSHOT). BioTechniques. 2000, 29: 52-54.PubMed
                15. Peakall R, Smouse PE: GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes. 2006, 6: 288-295. 10.1111/j.1471-8286.2005.01155.x.View Article
                16. Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P: MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes. 2004, 4: 535-538. 10.1111/j.1471-8286.2004.00684.x.View Article

                Copyright

                © Xiao et al; licensee BioMed Central Ltd. 2011

                This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                Advertisement