Skip to main content

Advertisement

Table 1 Degenerate PCR primers used for identification of genes encoding gut-associated peptidases of I. ricinus

From: Profiling of proteolytic enzymes in the gut of the tick Ixodes ricinus reveals an evolutionarily conserved network of aspartic and cysteine peptidases

peptidase cathepsin B cathepsin L cathepsin C cathepsin D
forward primer 5'CKTGYGGDTCTTGTTGGG 3' 5'CAGTGCGGVTCCTGCTGGGC3' 5'GTCGACACKCCYGCBAACTGCAC3' 5'TCACCCCAGCCKNCGTTCCA3'
reverse primer 5'GGCTCCTCTAAYYTBTGGGT 3' 5'GGCGATTCCGCACTGGTTGT3' 5'CCRTAGWAACCWCCMACATA3' 5'GAACACGTCNCCBARDATCCA3'
Sm* GenBank CAC85211 CAA83538 CAA83543 AAB63442
Sm* forward domain 117SSCGSCWA124 123LCGSCWA129 20ADTPANC26 85GSSNLWV91
Sm* reverse domain 313WNSDWGD319 304NMCGIA309 337YIGGYY342 355WILGDIF361
annealing temperature 55°C 53°C 62°C 53°C
product length 608 bp 554 bp 998 bp 855 bp
sequenced clones 12 8 8 8
isoforms 2 1 1 1
  1. *- orthologues in Schistosoma mansoni