Skip to main content

Advertisement

Table 1 List of primers used to validate oligoGEArray data.

From: Differential expression of Aedes aegypti salivary transcriptome upon blood feeding

  Accession number Primers (5' to 3') PCR Amplification efficiencies
Angiopoietin-like protein gi|94468605 GGCAATACAAAGCGTTCTGC 98.8%
   AAACCAAGCCAATACTCACCG  
Serine protease gi|18568305 TTGCTGTTGCTTCTTGCGT 97.2%
   CACATTCGTTGCTCTGGCTA  
30 kDa protein gi|61742032 GCTTTCCGTTGGCAGACTAA 98.8%
   AATCCGAGAAGTGTGGTCAGAC  
Mucin-like peritrophin gi|94468595 CAACAAGGAAACCACCTGTG 98.03%
   CAATCCAATCCCATTTGCTC  
Glycine rich protein gi|94469015 CAAGTGCTATTGCCATGGTT 97.6%
   GTGAGCAGCTGATCCAGACA  
Ribosomal protein (RpL5) gi|94468377 ATTACATTGCCGTCAAGGAG 99.2%
   TCATCATCAGCGAGTTGGTC