Skip to main content

Table 3 External and internal primer sets for the amplification of a partial region of the 18S gene of most filarial species.

From: A survey of canine filarial diseases of veterinary and public health significance in India

Primer name Sequence (5'-3')
PAFilariaF1 (external) GGTGAAACCGCGAACGGCTC
PAFilariaR1 (external) CCGTCCCTCTTAACCATTATC
PAFilariaF2 (internal) CTATAATGTACTTGATGTTGATTATC
PAFilariaR2 (internal) CCATGCACGAGTATTCAGGCA