Skip to main content

Table 1 Primers designed for real time PCR for DNV and CHIKV

From: Evidence of co-infection of chikungunya and densonucleosis viruses in C6/36 cell lines and laboratory infected Aedes aegypti (L.) mosquitoes

Virus Name of Primer Sequences Genomic Location
DNV Denso SYBR Fwd CAACGCTTGCTAACGGGAACGAC 2975-2997
  Denso SYBR Rev CAGTTGCTGCTGCTGATGTTAATCCGA 3072-3098
CHIKV CHIK Q Fwd TGGAGAAGTCCGAATCATGC 10316-10335
  CHIK Q Rev TAACTGTGACGGCATGGT 10445-10462
  1. *The sequence of the T7 polymerase site is represented in italics and underlined.