Skip to main content

Advertisement

Table 1 Primer sequences and other characteristics for each of 22 microsatellite loci amplified from 20 specimens of Schistosoma japonicum

From: Polymorphic microsatellites in the human bloodfluke, Schistosoma japonicum, identified using a genomic resource

Locus name Primer sequences (tails removed) Repeat unit Length of locus in Sj Genome draft (excl tails) Length range (PCR product - bp excl tail) No. of alleles In HWE? Ho He
SjP4 F:ACAAGCTCCAATCGTCTCTGA R:GAATACTGCCGCCCTTGTAA TAA 217 182-244 14   0.789 0.831
SjP9 F:GATGAAACAGATACCCAGCAC R:TGCATGTAAAAATGGCTTGC TAA 283 239-301 14 ** 0.600 0.915
SjP18 F:TCCTTTATCTGGGCTGTGGA R:TTTCAGCAGGATAACATGACG TGA 286 261-298 7   0.684 0.703
SjP19 F:GGTATCTTCGCTTTTTAGCATGG R:TCCTAGGGTGTGGTATCAGAG ATT 196 161-257 12 ** 0.737 0.896
SjP22 F:CAAAGCCTAAACGTCATAGACAG R:CAACCACCGATAAGTAGAGTGGA TTA 150 105-167 11 * 0.850 0.892
SjP23 F:GTACGATATGAGGGAAAGTTCA R:CTCTCCTTCAGACGAATTGAG TAA 219 192-253 14   1.00 0.933
SjP26 F:CAAGGGAACATTGTACATGAAG R:TGGTAAAGGAGAAAGTGAACG TAA 307 229-312 7   0.700 0.659
SjP28 F:TAACGCCTTTTCCCACATTC R:ATAACCACGATGGGAACCAA TTA 242 232-269 13 ** 0.900 0.926
SjP32 F:TGTCACCGAGTCTTCATTAGC R:ACAGTCAGTAGACCTGGATAAAC TTA 175 142-192 14   0.950 0.929
SjP34 F:GGCGACCATACATAAGGAGAAT R:GACCGATTTCTAATGGAGCA TAA 409 381-430 13 * 0.778 0.908
SjP37 F:TCCTTGACACGAGGTACATGT R:ATTACGTAACAGAAGGCTGGA TAT 290 240-314 8   0.833 0.714
SjP39 F:GACGACTGTTAAGTCCATCTGA R:ATAACCAATCTCCACGAAAGC ATT 239 223-251 8   0.900 0.871
SjP42 F:GCTGCAGCTTCTGTGTAGTAA R:GTCTTGCTCAGATCAGTTCGT TAA 216 199-234 9   0.950 0.855
SjP43 F:ACAATGGCTATTGGTTGAGTAG R:GGAGCATGCGTATATGGAAAA TAA 188 184-235 9   0.750 0.854
SjP45 F:ATAACACCGAATCTGTTCAGC R:TAATCCGGTCAGGATGTATGT TAT 156 150-244 13   0.850 0.921
SjP48 F:TTGTTGGGTAGTGATGGTAGG R:TAGTTCATTCCACCTCTTGGA TAA 246 251-273 6   0.650 0.795
SjP54 F:TTAGGCTTGTTGGTGCTGATA R:AGGTAAAGCAAATCCCATAGC GGTA 437 373-446 9   1.00 0.712
SjP58 F:TCCCAGTACCAATGTAGATGTG R:CTAATAAAGTCGTCAAGGAGCA AAT 227 439-499 12 ** 0.800 0.921
SjP60 F:CGATTCATTCATAGCCTGACT R:GAATCCCATCACAGATTAACG TAT 155 134-165 10   0.900 0.867
SjP61 F:TCATCTTGTCACCAACTAGGC R:GCTTGGAGGAGGCTAAAATAC TAT 188 158-238 9   0.700 0.679
SjP63 F:ACCGCCACTACCACTAACCTCA R:TTGACCTGAAATCTGTCCCTA TAA 390 333-389 13 ** 0.800 0.904
SjP88 F:GCTTTCCAGGCATAAACTTCAC R:TCTCCTAATGATGGGAACAG TAA 408 380-417 9   0.950 0.887
  1. Sequences of microsatellites reported here have been deposited in GenBank [AB604199 - AB604218].
  2. Note that the first two loci are from [10] and are included for comparative purposes.
  3. The annealing temperature of PCRs for all loci is 55°C
  4. * P < 0.05 ** P < 0.01 as determined in GenAlEx.