Molecular identification and transmission studies of X-cell parasites from Atlantic cod Gadus morhua (Gadiformes: Gadidae) and the northern black flounder Pseudopleuronectes obscurus (Pleuronectiformes: Pleuronectidae)

Table 1 PCR primers used for the nested amplification of X-cell SSU rDNA.

nested primer pairs	fwd primer (5'-3')	rev primer (5'-3')	annealing temp °C	size (bp)
cod
i) 305f^s/H-R3M^x	tgacctatcatgctgtgatgg	taggaattcctcgttcaagacg	54	1350
ii) 390Xf^x/1400r^s	agagggagcctgagagacg	agcaagcccgtatggagaagacg	52	1000
flounder
i) 280f^s/H-R3M^x	atccatcagccatcgacgc	taggaattcctcgttcaagacg	55	1290
ii) 390Xf^x/1000r^s	agagggagcctgagagacg	tcgtccgatcctcagtcgg	55	645

ISSN: 1756-3305