Skip to main content

Advertisement

Table 1 PCR primers used for the nested amplification of X-cell SSU rDNA.

From: Molecular identification and transmission studies of X-cell parasites from Atlantic cod Gadus morhua (Gadiformes: Gadidae) and the northern black flounder Pseudopleuronectes obscurus (Pleuronectiformes: Pleuronectidae)

nested primer pairs fwd primer (5'-3') rev primer (5'-3') annealing temp °C size (bp)
cod     
i) 305fs/H-R3Mx tgacctatcatgctgtgatgg taggaattcctcgttcaagacg 54 1350
ii) 390Xfx/1400rs agagggagcctgagagacg agcaagcccgtatggagaagacg 52 1000
flounder     
i) 280fs/H-R3Mx atccatcagccatcgacgc taggaattcctcgttcaagacg 55 1290
ii) 390Xfx/1000rs agagggagcctgagagacg tcgtccgatcctcagtcgg 55 645
  1. s X-cell species-specific primer
  2. x X-cell universal primer