Skip to main content

Advertisement

Table 1 Primer sequences used in Real-time RT-PCR

From: Evaluation of Toxoplasma gondii as a live vaccine vector in susceptible and resistant hosts

Sequence no Gene name Primer sequence
1 IFN-γ F- CGCACATCAAACACATATCTG R- GATTCTCAAGTCGTTCATCGG
2 IL-4 F-AGGCAACACTACTTCAATGG R-GCTAGTTGGTGGAAGAAGGT
3 Actin F-CCACACTTTCTACAATGAGCTG R-GGTCTCAAACATGATCTGTGTC