Skip to main content

Table 1 Primers and probes used in this study for PCR and RLB.

From: Small risk of developing symptomatic tick-borne diseases following a tick bite in the Netherlands

Name Sequence (5' - 3') Type Target Species Reference
5S borSeq GAGTTCGCGGGAGAGTAGGTTATTGCC (1) Primer 23S-5S IGS B. burgdorferi sensu lato [38]
23S borSeq TCAGGGTACTTAGATGGTTCACTTCC Primer 23S-5S IGS B. burgdorferi sensu lato [38]
A-borsl1 CTTTGACCATATTTTTATCTTCCA Probe 23S-5S IGS B. burgdorferi sensu lato [39]
A-borsl2 CTTCCATCTCTATTTAGCCAATTT Probe 23S-5S IGS B. burgdorferi sensu lato [38]
A-borsl3 TATTTTTATCTTCCATCTCTATTTT Probe 23S-5S IGS B. burgdorferi sensu lato [38]
B31-A-s.stricto AACACCAATATTTAAAAAACATAA Probe 23S-5S IGS B. burgdorferi sensu stricto [39]
Ga2-garinii AACATGAACATCTAAAAACATAAA Probe 23S-5S IGS B. garinii [39]
Vs46lN2afzelii AACATTTAAAAAATAAATTCAAGG Probe 23S-5S IGS B. afzelii [39]
VsII62 val CATTAAAAAAATATAAAAAATAAATTTAAGG Probe 23S-5S IGS B. valaisiana [39]
A-Ruski GAATAAAACATTCAAATAATATAAAC Probe 23S-5S IGS B. afzelii (variant ruski) [40]
A-LusiP CAAAAAAATGAACATTTAAAAAC Probe 23S-5S IGS B. lusitaniae [41]
B-GA1b CGGGATCCCGAGTTTGCCGGGACTTCTTCT (1) Primer 16SrRNA Ehrlichia/Anaplasma [42]
16S8Fe GGAATTCAGAGTTGGATCMTGGYTCAG Primer 16SrRNA Eubacteria [43]
Ehr-all TTATCGCTATTAGATGAGCC Probe 16SrRNA Anaplasma genus [42]
A-HGE GCTATAAAGAATAGTTAGTGG Probe 16SrRNA HGE agent [42]
A-Eqph TTGCTATAAAGAATAATTAGTGG Probe 16SrRNA A. phagocytophilum [42]
A-dHGE GCTATGAAGAATAGTTAGTG Probe 16SrRNA HGE agent (variant) [42]
A-dPh TTGCTATGAAGAATAATTAGT Probe 16SrRNA A. phagocytophilum variant [38]
A-E.Schot GCTGTAGTTTACTATGGGTA Probe 16SrRNA A. schotti (variant) [42]
A-murisT AGCTATAGGTTTGCTATTAGT Probe 16SrRNA E. muris T variant [40]
A-Chaff ACCTTTTGGTTATAAATAATTGTTA Probe 16SrRNA E. chaffeensis [42]
A-can TCTGGCTATAGGAAATTGTTA Probe 16SrRNA E. canis [42]
A-Wolbach CTACCAAGGCAATGATCTA Probe 16SrRNA Wolbachia [38]
Rick-16S rev ACTCACTCGGTATTGCTGGA (1) Primer 16SrRNA Rickettsia genus [41]
Rick-16S for AACGCTATCGGTATGCTTAACA Primer 16SrRNA Rickettsia genus [41]
A-Rickall TTTAGAAATAAAAGCTAATACCG Probe 16SrRNA Rickettsia genus [41]
A-Rhelv2 GCTAATACCATATATTCTCTATG Probe 16SrRNA R. helvetica [41]
A-Rconor CTTGCTCCAGTTAGTTAGT Probe 16SrRNA R. conorii [41]
A-16SRickIRS GTATATTCTCTACGGAAAAAA Probe 16SrRNA Rickettsia IRS3 [41]
A-RProwaz CGGATTAACTAGAGCTCGCT Probe 16SrRNA Rickettsia prowazekii [34]
A-RTyphi CGGATTAATTAGAGCTTGCT Probe 16SrRNA Rickettsia typhi [34]
A-NonHelv A AATACCGTATATTCTCTACGGA Probe 16SrRNA Non- Rickettsia helvetica [34]
A-NonHelv B AATACCGTATATTCTCTGCGGA Probe 16SrRNA Non- Rickettsia helvetica [34]
BATH-Rn TAAGAATTTCACCTCTGACAGTTA (1) Primer 18SrRNA Babesia genus [44]
BATH-Fn ACACAGGGAGGTAGTGACAAG Primer 18SrRNA Babesia genus [44]
Catch all 2 GTAATGGTTAATAGGARCRGTT Probe 18SrRNA Babesia genus [44]
Ba-div GTTAATATTGACTAATGTCGAG Probe 18SrRNA B. divergens [45]
Ba-mic 1 CCGAACGTTATTTTATTGATTT Probe 18SrRNA B. microti [34]
Ba-mot GCTTGCTTTTTTGTTACTTTG Probe 18SrRNA B. motasi [44]
Ba-mic 2 GRCTTGGCATCWTCTGGA Probe 18SrRNA B. microti [44]
Ba-EU1 CTGCGTTATCGAGTTATTG Probe 18SrRNA B. EU1 [34]
  1. Probes were 5'-amino-labeled. (1) Reverse primer 5'-labeled with biotine tetraethyleneglycol