Skip to main content

Table 1 Sequences and primer sets for the amplification of a partial region of the omp B gene of SFG rickettsiae and glt A gene of R. felis

From: Molecular evidence of Rickettsia felis infection in dogs from northern territory, Australia

Gene Primer name and sequence (5'-3') Product size
omp B omp B-F (CGACGTTAACGGTTTCTCATTCT)
omp B-R (ACCGGTTTCTTTGTAGTTTTCGTC)
252 bp [10]
glt A gltA-F1 (GCAAGTATTGGTGAGGATGTAATC)
gltA-R1 (CTGCGGCACGTGGGTCATAG)
gltA-F2 (GCGACATCGAGGATATGACAT)
gltA-R2 (GGAATATTCTCAGAACTACCG)
654 bp