Skip to main content

Advertisement

Table 1 Primers used for amplification and sequencing of Ixodiphagus hookeri (Howard) DNA

From: Parasites of vectors - Ixodiphagus hookeri and its Wolbachia symbionts in ticks in the Netherlands

Primer Target sequence 5' → 3' original name Reference
16S-F1 16S rRNA cacctgtttatcaaaaacat 16SWb [32]
16S-F2 16S rRNA ctgcagtattttgactgtacaaaggtagcataatc -- This study
16S-R1 16S rRNA cttaattcaacatcgaggtcgc -- modified from [33]
28S-F1 28S rRNA aagagagagttcaagagtacgtg -- [34]
28S-F2 28S rRNA actttcaggacccgtcttga -- R/C of 28S-R1
28S-R1 28S rRNA tcaagacgggtcctgaaagt D2-4057 R [35]
28S-R2 28S rRNA tagttcaccatctttcgggtccc 28S-PM [34]
28S-R3 28S rRNA tcggaaggaaccagctacta D3-4413 R [35]
  1. R/C: reverse-complement