Skip to main content

Advertisement

Table 2 Primers used for amplification and sequencing of Wolbachia DNA

From: Parasites of vectors - Ixodiphagus hookeri and its Wolbachia symbionts in ticks in the Netherlands

Primer Target sequence 5' → 3' original name Reference
wsp 81F wsp gene tggtccaataagtgatgaagaaac wsp 81F [23]
wsp 691R wsp gene aaaaattaaacgctactcca wsp 691R [23]
wspF2a wsp gene aaggccacagacattcataatccattaaaagcatc -- This study
wspF2b wsp gene gcaacaggcaaagaaaaggatagtccct -- This study
wspR2a wsp gene acagtgctgtaaaggactgtatgtcctcctttg -- This study
wspR2b wsp gene acagtgctgtaaaggactgtatgtcctcctttg -- This study