Skip to main content

Advertisement

Table 1 Primers used for quantitative PCR analysis of genes related to dopamine metabolism

From: The w MelPop strain of Wolbachia interferes with dopamine levels in Aedes aegypti

Accession Primer Sequence 5'-3' Amplicon (bp)
AAEL004175-RA Ae-RpS17F CACTCCCAGGTCCGTGGTAT 81
  Ae-RpS17R GGACACTTCCGGCACGTAGT  
AAEL014238-RB Ddc F GGTGGACTACATCGCCAACT 166
  Ddc R GACACCAGGCATGATGACAC  
AAEL005793-RA Ebony F GAATCGGGACGGAGATTACA 198
  Ebony R ACGGCCACATTTTCGTAGTC  
AAEL011764-RA Ppo011764 F CTGAACAACGGATTCCCATT 165
  Ppo011764 R TCATCAACGTCTGCACATCA  
AAEL006877-RA Ppo006877 F CTATACGGCTTCGGATCGAG 184
  Ppo006877 R GTACCGAGCCATCGTTTGTT  
AAEL013501-RA Ppo013501 F CTTCGGATCGAGAGCTTGAG 176
  Ppo013501 R GTACCGAGCCATCGTTTGTT  
NC_002978: c537094-538083 ANK550 F CAGGAGTTGCTGTGGGTATATTAG 74
  ANK550 R TGCAGGTAATGCAGTAGCGTAAA