Skip to main content

Advertisement

Table 1 Primer sequences used to amplify the target transcripts from total RNAs isolated from LMM-cut Aedes aegypti midgut tissues.

From: High quality RNA isolation from Aedes aegypti midguts using laser microdissection microscopy

Gene ID Primer sequence (5' to 3') Product size Name
DQ440299 Forward: AACCAAGCAAACCCAAACC Reverse: AGGATACCGTTGGCATCG 195 bp Heat shock cognate 70
AAEL015246 and AAEL012410 Forward:GCGGACGTAACTCATCCAC Reverse: CCCTGGTGACTGCAGAGATAG 498 bp AGO1a and b
AAEL017251 Forward: TCAAGCAGACGAACCAAA Reverse: ATGGCACGAAGTTCTATGG 103 bp AGO2
AAEL001466 Forward: TCTAACGCATACGCACCAC Reverse: TGTCGTCACCAGAGCAATG 130 bp hypothetical protein