Skip to main content

Advertisement

Table 1 Probes and primers used in this study

From: Molecular identification of Clonorchis sinensis and discrimination with other opisthorchid liver fluke species using multiple Ligation-depended Probe Amplification (MLPA)

Primer Oligonucleotides Sequences(5`-3`)
CsPLaw PaACATACATGTAGAACATGACGG GTTCGGGCAATTCGTTATTGGCCCTATAGTGAGGTCTTCTCTATTGTCACCGT ATGCACATCTCGGAATCAAGCTGg
CsPLfw hACTGGATTCAGGTTCACGA AGCTGCATTATCGATCAGTACCAGTGTAGTACAGCGCCGGTGAAATTATCGCCACAGGCCTTTCTGCAGCATGCATGCGGAb
OfPLaw PcCTATACATGTAGAATATGACGGA GTTCGGGCAATTCGTTATTGGCCCTATAGTGAGGTCTTCTCTATTGTCACCGTATGCACATCTCGGAATCAAGCTGg
OfPLfw hACTGGATTCAGGTTCACGA AGCTGCATTATCGATCAGTTATCGCCACAGGCCTTTAACGCTGCAGCATGTATGTd
OvPLaw PeTTATACATGTAGGTTATACATGAC GTTCGGGCAATTCGTTATTGGCCCTATAGTGAGGTCTTCTCTATTGTCACCGT ATGCACATCTCGGAATCAAGCTGg
OvPLfw hACTGGATTCAGGTTCACGA AGCTCAGGCCTTTAACGCTGCAGCATGTATGGf
pF3 Fam-CAGCTTAGTTCCGAGATGT
pB3 ACTGGATTCAGGTTCACGA
Cs-T CCGTCATGTTCTACATGTATGTTCCGCATGCATGCTGCAG
Of-T TCCGTCATATTCTACATGTATAGACATACATGCTGCAGCGTT
Ov-T GTCATGTATAACCTACATGTATAACCATACATGCTGCAGCGTT
ITS1f CGATTCTAGTTCCGTCATCT
ITS1r CCGCTCAGAGTTGTACTCAT
  1. a-f: complementary sequence of ITS loci in padlock probes, denoted with italics and bold.
  2. g: pF3 binding sequence in underline and bold.
  3. h: pB3 binding sequence in underline.
  4. P: phosphorylated
  5. Fam: Fam fluorescent labled at the 5' end.