Skip to main content

Table 1 Relative quantitative real-time PCR primers and probes

From: Analysis of Babesia bovis infection-induced gene expression changes in larvae from the cattle tick, Rhipicephalus (Boophilus) microplus

EST Primers Taqman Probe
TC293 FW 5’ AACATCTACAGCAAGTTTGACACC 3’ 5’ FAM- AGGTGACCGCCTGGATACTCCGCA-TAMRA 3’
RV 5’ CCCGTCGATGCAGGTTTTGG 3'
BEAI101TR FW 5’ CGGAAGAAACGAGAAATACGAGAC 3’ 5’ FAM- TGCGTCGGCACACACTGGTACAGC-TAMRA 3’
RV 5’ TACATGAGAACAGTAGCATATAGGG 3’
TC12256 FW 5’ CTTCACATTCAACACGCCCTAC 3’ 5’ FAM-AGCCACAGCAACGCCATCGCCG-TAMRA 3’
RV 5’ AAAACCGCTACGGCAAATGC 3’
TC14244 FW 5’ TTAAACATTCTTTCGCTCATCAGTC 3’ 5’ FAM-CCGCACGACGCAAGCCGAAA-TAMRA 3’
RV 5’ TACATGAGAACAGTAGCATATAGGG 3’
18S FW 5’ CCTGAGAAACGGCTACCACATC 3’ 5’ FAM-AGGAAGGCAGCAGGCGCGC-TAMRA 3’
  RV 5’ GTGCCGGGAGTGGGTAATT 3’  
  1. a Based on BmiGI Version 2 designations (http://compbio.dfci.harvard.edu/tgi/cgi-bin/tgi/gimain.pl?gudb=b_microplus).
  2. b Forward (FW) & reverse (RV).