Skip to main content

Advertisement

Table 2 Primers and probes used for real-time detection of TBEV*

From: Prevalence of tick borne encephalitis virus in tick nymphs in relation to climatic factors on the southern coast of Norway

Primer name Sequence (5’ → 3’) Genom position GenBank accession No.
TBE 320F GGGAGCGCAAAACTGGAA 1662–1680 U27495
TBE 373R TGAGGAGCCCCAAATTCAAC 1696–1715 U27495
TBE 339 probe (FAM)-AACGCAGAAAGAC-(BHQ1) 1681–1693 U27495
  1. *Designed by T. Tengs at the Norwegian veterinary institute.