Skip to main content

Table 1 PCR primers used in the present study

From: Molecular epidemiological studies on animal trypanosomiases in Ghana

Organism Target gene Primer Sequence (5' to 3') Amplicon size (bp) Annealing temperature (°C) Reference
Trypanosoma spp. ITS1 rDNA ITS1 CF CCGGAAGTTCACCGATATTG Variable 58 [8]
T. congolense Kilifi Satellite DNA monomer TCK 1 GTG CCC AAA TTT GAA GTG AT 294 55 [15]
T. congolense Forest Satellite DNA monomer TCF 1 GGA CAC GCC AGA AGG TAC TT 350 55 [15]
T. congolense Savannah Satellite DNA monomer TCS 1 CGA GAA CGG GCA CTT TGC GA 316 55 [15]
T. vivax Cathepsin L-like gene DTO 155 TTAAAGCTTCCACGAGTTCTTGATGATCCAGTA 177 65 [14]
T. evansi RoTat1.2 VSG gene TeRoTat 920 F CTGAAG AGGTTGGAAATGGAGAAG 151 58 [16]
T. b. rhodesiense SRA gene Forward ATAGTGACAAGATGCGTACTCAACGC 284 68 [17]
T. b. gambiense TgsGP gene sense GCTGCTGTGTTCGGAGAGC 308 63 [18]