Skip to main content

Table 2 Repeat motif, primers sequence, and annealing temperature used for PCR amplification of the microsatellite loci in Phlebotomus papatasi collected from different populations in Sudan and Egypt

From: Evidence for genetic differentiation at the microgeographic scale in Phlebotomus papatasi populations from Sudan

Locus Motif Fluorescent labeled primer sequence Annealing T°
*Pap1 (GTT) FAM-CGGTCACTTCCCTCTTCTCA 58°C
   R: CCCCTTCTACAACCACTTCAA  
*Pap2 (CA) JOE-CACTCGCAAGATGGTAGGGTA 58°C
   R: CGGCGCCTATAGACAGAGAA  
*Pap4 (GAA) FAM-GTGGCAAAATTGGTTTGGT 55°C
   R: ACCTTTTGCATATGCCCATC  
AA13 (GAG) TAMRA-CTCCAACTCCTCATCCACCTC 59/55°C
   R: GGCGACGAATGGGACAAAG  
AA18 (AGC) JOE-5’-GCTGCACAGCCGCCTGATG 55°C
   R: ATCAGCAGACACTCCAGCAACACC  
AA24 (GCA) TAMRA-5’-CTATTCCCGCCCCACTTGG 55°C
   R: TCAATCGACATTCGGACAGGC  
AA82 (GGA) JOE-TCAACCAAGGTAGTCTCATCAG 49°C
   R: GAGGACTTCCGATTTCTGTAG  
  1. † Fluorescent marker dyes used in this study are indicated in bold.
  2. *Designed by Hamarsheh et al. (2006) for P. papatasi.
  3. Designed by Aransay (2001) for P. perniciosus.