Skip to main content

Table 1 Primers for quantitative RT-PCR

From: Semi-artificial mouse skin membrane feeding technique for adult tick, Haemaphysalis longicornis

Gene name and primer ID Primer sequences (5′ to 3′)
β-actin
 HlActin8F1 CCCATCTACGAGGGTTACGCTC
 HlActin9R1 CATCTCCTGCTCGAAGTCCAGG
HlSP (serine protease)
 HlSPEf2 TCCTTCCTCCTGAAGCAG
 HlSPEr2 CGTTCGCTATCCATGGTC
Longepsin (aspartic protease)
 longepsin_f2 CATGAACGGCGTGAAAGTAG
 longepsin_r2 TCCTTGCCTTCCAAAACG
Longipain (cysteine protease)
 longipain_f1 ACCCTGCGACAAGAGCATAC
 longipain_r1 TCCACTTGAATCTGCGTCAC
HlSCP1 (serine carboxypeptidase)
 HlSCP1_f1 TGCTTCAGACTGCATTGACC
 HlSCP1_r1 TTGACCGCAGGTGTCATATC
HlLgm (legumain)
 HLleg1RTf1 CGACGAGCAAATCGTAGTCA
 HLleg1RTr1 ACTTTTCCGCTTCCTCCATT
HlLgm2 (legumain)
 B32G12f1 CCTTCGCAACAAGCTAAAGG
 B32G12r1 TCAGAAGTCCTTCGGTGCTT
HlLAP (aminopeptidase)
 HlLAPf1 CGCTAAGAAGCAGGCTGTCCTA
 HlLAPr1 TCAGACCGTAGAAAACTCTGGAC
HlLAP2 (aminopeptidase)
 HlLAP2f2 AAGGCTCTTCACGAAGTGGA
 HlLAP2r1 TGGTCGACACCTCGAACATA
Hlgut-defensin (anti-microbial peptide)
 EF132731 F GGGACTTTTACTGGCTTTCCTG
 EF132731 R ACACGCCCTTTCATCGAAC