Skip to main content

Table 1 Primers used in this study

From: Quantitative PCR-based genome size estimation of the astigmatid mites Sarcoptes scabiei, Psoroptes ovis and Dermatophagoides pteronyssinus

Gene Primer Sequence (5'-3') Size
Actin (S. scabiei) SsAct F CAACCATCCTTCTTGGGTATG 311 bp
  SsAct R CCAGCTTCGTCGTATTCTTGT  
Actin (P. ovis) PoAct F CATCAAGGTGTCATGGTTGG 225 bp
  PoAct R GGCTTTTGGATTCAATGGAG  
Actin (P. pastoris) PpAct F AGCGCGCCCATTTCTTACCGT 203 bp
  PpAct R TCTCCGGCGTATCCGGCCTT  
EF1a (S. scabiei) SsEF1a F TTGGCTTATACCTTGGGTGTG 181 bp
  SsEF1a R CACCGTTCCATCCAGAGATT  
EF1a (D. pteronyssius) DpEF1a F CCCGTGAACATGCTTTGCTTGCC 175 bp
  DpEF1a R ACAAAAGCGACGGTAGCCGGA  
EF1a (P. ovis) PoEF1a F CAAATATGCCTGGGTTTTGG 205 bp
  PoEF1a R TTCACCAGTACCAGCAGCAA  
EF3 (P. pastoris) PpEF3 F GTCGCCATTTTGGATGCTAT 251 bp
  PpEF3 R AGGGTGTGGACAGTTTCTGG