Skip to main content

Table 1 Genes analysed by Taqman quantitative real-time PCR

From: Immunoregulation of bovine macrophages by factors in the salivary glands of Rhipicephalus microplus

Gene name NCBI Accession Sense Anti-sense Probe: FAM-TAMRA
CD86 NM_001038017 TAAGGCCGACAGCAGTTTCC TCACCCCGTTATTAAGATGATAGC TCCCAGCTCTGCTTCCAGTCGGGT
CD80 Y09950 GCATTGTGATCCTGGCTCTG CTGATCATTAACCTCACGGAAGTC TGTCGGACAGTGGCACCTACACCT
CD40 NM_001105611 GCATTGTGATCCTGGCTCTG CTGATCATTAACCTCACGGAAGTC TGTCGGACAGTGGCACCTACACCT
CD69 NM_174014 ACCTTGGCCCAAAACTTTTGC CAGCCCGATCCAGTGTTCAG AACATGGTGCCACGCTTGCTGTCA
IFN-γ NM_174086 GAAAGCGGAAGAGAAGTCAGAATC CAAATATTGCAGGCAGGAGGAC ACGTTGATGCTCTCCGGCCTCGAA
IL-12p40 NM_174356 TGTGACACTCCTGAAGAAGATGG CCAAACTCTTTGACTTGGATGGTC TGCCAGAGCCCAAGACCTCACTGC
IL-10 NM_174088 CTCTGTTGCCTGGTCTTCCTG TGGTTGGCAAGTGGATACAGC CAGCCAGCCGAGATGCGAGCACC
IL-4 NM_173921 AGCAAGACCTGTTCTGTGAATG CAGCTTCAACACTTGGAGTATTTC AGCCAAGACGAGCACAAGTACGCT
  1. Gene names, NCBI gene accession, sense and anti-sense primer sequences (5' to 3') and Taqman probe sequence.