Skip to main content

Table 1 Biomolecular method used for pathogen identification, target genes, primers, probes and references.

From: Occurrence and identification of risk areas of Ixodes ricinus-borne pathogens: a cost-effectiveness analysis in north-eastern Italy

Species method gene primers Nucleotide sequence (5'- 3') Amplicon
size (bp)c
Ref.
Ixodes PCR 16S ribosomal RNA F-16sIxodes AAAAAAATACTCTAGGGATAACAGCGTAA 97 [12]
(extraction control)    R-16sIxodes ACCAAAAAAGAATCCTAATCCAACA   
    16s-Ixodes-Probe TTTTGGATAGTTCATATAGATAAAATAGTTTGC GACCTCG   
B. burgdorferi s.l. real time PCR (duplex) 23S-rRNA Bb23Sf CGAGTCTTAAAAGGGCGATTTAGT 75 [14]
    Bb23Sr GCTTCAGCCTGGCCATAAATAG   
    Bb23Sp-FAM AGATGTGGTAGACCCGAAGCCGAGTG   
A. phagocytophilum real time PCR (duplex) msp2 ApMSP2f ATGGAAGGTAGTGTTGGTTATGGTATT 77 [14]
    ApMSP2r TTGGTCTTGAAGCGCTCGTA   
    ApMSP2p-HEX TGGTGCCAGGGTTGAGCTTGAGATTG   
B. burgdorferi s.l. PCR flagellin FLA1 AGAGCAACTTACAGACGAAATTAAT 482 [16]
    FLA2 CAAGTCTATTTTGGAAAGCACCTAA   
A. phagocytophilum PCR msp2 msp2-3f CCAGCGTTTAGCAAGATAAGAG 334 [15]
    msp2-3r GMCCAGTAACAACATCATAAGC   
TBEv rRT-PCR 3' non-coding region F-TBE 1 GGGCGGTTCTTGTTCTCC 67 [12]
    R-TBE 1 ACACATCACCTCCTTGTCAGACT   
    TBE-Probe-WT TGAGCCACCATCACCCAGACACA   
TBEv nested PCR non-structural protein NS5 FSM-1 GAGGCTGAACAACTGCACGA 357 [13]
    FSM-2 GAACACGTCCATTCCTGATCT   
   non-structural protein NS5 FSM-1i ACGGAACGTGACAAGGCTAG 251  
    FSM-2i GCTTGTTACCATCTTTGGAG   
Rickettsia spp. PCR citrate synthase RpCS.877p GGGGGCCTGCTCACGGCGG 381 [17]
    RpCS1258n ATTGCAAAAAGTACAGTGAACA   
Cand. N. mikurensis PCR groEL NM-128s AACAGGTGAAACACTAGATAAGTCCAT 1024 [19]
    NM-1152as TTCTACTTTGAACATTTGAAGAATTACTAT   
Babesia/Theileria PCR 18S rRNA RLB-F2 GACACAGGGAGGTAGTGACAA 400 [18]
    RLB-R2 CTAAGAATTTCACCTCTGACAGT