Skip to main content

Table 2 Primers and UPL used for genospecies identification of Borrelia burgdorferi s.l. in co-infected ticks using real time PCR assays

From: Occurrence and identification of risk areas of Ixodes ricinus-borne pathogens: a cost-effectiveness analysis in north-eastern Italy

Genospecies Target gene 5'→ 3'primer sequence UPL number Amplicon
size (bp)c
B. burgdorferi s.s. OspAa TCTTGAAGGAACTTTAACTGCTGA
TGAAACTTCCCCAGATTTTGA
#119 97
B. afzelii OspA GACTCCGCAGGTACCAATTT
AAAGCGTTTTTAAGTTCATCAAGTG
#98 71
B. garinii Flab TCTGCTATGATTATGCCACCA CCTTTGCCTAAGAATTGATTACCA #2 74
B. valaisiana Fla CCAAATGCACATGTTGTCAAA
TTTGCAGGTTGCATTCCA
#132 78
  1. aOspA: Outer surface protein A gene; bFla: flagellin gene; cbp: base pairs