Skip to main content

Table 2 Microsatellite primers used in this study

From: Population genetic structure of Aedes polynesiensis in the Society Islands of French Polynesia: implications for control using a Wolbachia- based autocidal strategy

Locus Primer sequence (5'-3') Repeat Cloned size (bp) Reference
APT1 F: CTCTGGCCAAAACAGAGACC
R: CAGCAGTTCAAAGGATGTCG
(GCC)5 164 This study
APT2 F: GATCCTTCGGGATGACACAG
R: GAGCAAAAGTAGCCCACAGC
(GT)11 154 This study
APT6 F: TTCCTCGTTTCTCATTTTTCC
R: GAGACCCAAATCAAAGACACG
(GT)10 181 This study
AealbA9 F: TGGGACAAGAGCTGAAGGAT
R: CTCGTTCTCTACTCTCTCCGTT
(AC)4 N4(AC)8 N4 (AC)2 N2 (AC)N2 (AC)N (AC)N2(AC) 152 [22]
AP1 F: GCACCAGAGCAAAAGTAGCC
R: GGGAAGAGAAAGAAGCACCC
(AC)14 N3(CG)5 129 [21]
AP2 F: ATTACCGCCGTACTGCTGAG
R: CATCACCACCATCACCAAAC
(TGC)12 N6(TGA)4 148 [21]
AP3 F: AGGAGTGTTCTGCTGTTGGG
R: GCAAACTTTTCCCTTCCTCC
(TGC)5 111 [21]
AP4 F: CCACAAAAAGCCAAAAGAGC
R: ACTTGGGAGTGATGGTGTGG
(TCA)6 151 [21]
AP5 F: AGATGGTGCTGGGTGAAGAC
R: AGTGCAAACAACACCAGCAG
(TGG)4 N30(TGC)4(TGT)3 N12(TGA)3 144 [21]
AP6 F: CTACTCTGTAGACCATGGCGG
R: TCAGCGGAGAGTTGATGTCC
(CT)N26(CAC)3 N36(CAC)3(CAG)4(CA)3 186 [21]