Skip to main content

Advertisement

Table 1 P. vivax microsatellites and their primers used for PCR amplification and detection of nucleotide fragment length

From: Molecular and epidemiological characterization of Plasmodium vivax recurrent infections in southern Mexico

Microsatellite Chromosome Repeat unit Primers
MS 040 6 AAAT F 6FAM- ATTTGCGTACGGTTAAGAT
R CAGGGTTATTCAATTTGCT
MS 092 5 GAA F 6FAM- TCACTGATCTTTTCGCATG
R TAGTAGCATAGTGGTAGTA
MS 116 10 GAA F NED- AAATGCAAGATCCAAGAAAT
R GTCGCTCTTCATGTGGCA
MS 033 3 CAT F 6FAM- CGATTCGTGCTATTTGC
R CCTGCTACATATTTGGC
MS 176 14 AT F 6FAM- ATAATGGCGTCATCCTTCA
R TTCAGCATGCGCTGTTTAT
MS 315 3 AT F NED- TTAACGGTTAATCCTCTATT
R TTGTGTCTATTTGGCCATT
MS 206 12 GTT F 6FAM- TCTTTATGTTGTACTGCTC
    R ACCACTTACAAAAGTGTGA
  1. MS, microsatellite; F, forward; R, reverse.