Skip to main content

Advertisement

Table 1 Microsatellite markers of L. aethiopica developed and tested in this study

From: Multilocus microsatellite signature and identification of specific molecular markers for Leishmania aethiopica

CO REPEAT ARRAY FORWARD PRIMER SEQUENCE (5′-3′) REVERSE PRIMER SEQUENCE (5′-3′) CHROMOSOME LOCATION POLYMORPHISM
1 (CA)10 TGAACAGTACGTCCAGGAGGA GTGGTGGAAGAGGGAGAGAG NA P
3 (GT)20 TCTTGCTTACGCGTGGACTA ACGAGGCAGGAGGGAGAG Lmj11 NA
4 (CA)12 TGCGCCAGTTTCTATGACTG TGTGTTTGTGTGCGTGGATA Lmx32, Ld33 P
5 (GT)10 TTATGATGTAGGCAGGGTAGAGT GTATTGGGCAAAGGGACCTT Lmj31, Ld31 NA
6 (CA)29 TGCTCATGGTGGATGTGC GTCGTGTGGTCGTGTATGTG Lmj31 P
7 (CA)12 TTCGTCGCTCTTGTCTCTTG TAGTCCACGCGTAAGCAAGA Lmj24 NA
8 (CA)15 TCCCTCTCTTCCTCTGTTCC CAGATGCGCAAGAATCAAAA Lmj, Ld15 NA
11 (CA)16 CTCCCTCTCTTCCTCTGTTCC TCTCTCGGTGAGCCAGATG Lmj, Ld15 NA
13 (GT)16 GGTCGTTGTGACGCCAGT ACTGCGTTCTGTGTGTCTCCT Lmj31 NA
15 (GT)10 CCACCACCACACTTTTTCGT GATACCGGCTGATGATGAGG NA NA
16 (GT)13 TCTTGCCTCTTTAATCTGTGTCC GTTGTGGTGGTTGATCCGTT Lmj34 NA
17 (CA)28 CTCACACATGGATGCAAAGC CGTGTGTGTGTGCCATACAA NA NA
18 (GT)21 GGAGGGGGAGGAGTCTAAAA TGTACTGCCGAGATTGAACG Lmj34, Li31,34, Ld8, 34 NA
19 (GT)50, 30 TCTTGCTTACGCGTGGACTA TAGAGTTGATTGCACGTGGC Lmj12 NA
20 (GT)11 TACTTCGCGCACCGTCTCT TTGTCGGTCGTGACTACTGC Lmj26 NA
21 (GT)20 GCTTACGCGTGGACTACCA CTATCGAGGGTCGGCAAC Lmj11,26 NA
22 (GT)16 GGCGCGATATCCACTTCTT TGTAAGTGTGTGGGTGGGTG Lmj18, Lin18 P
23 (GT)12 GTGGGTTTTTGAATTATGTCGTC GTATTGGGCAAAGGGACCTT Lmj31, Ld31, Lin31, Lmx30 NA
26 (GT)15 TCTTGCTTACGCGTGGACTA TAGAGTTGATTGCACGTGGC Lmj12, Ld12 NA
27 (GT)40 CGTACGTCTGTTGCCTCTGT CACTACTCCGCAGAACCGTA Ld26 P
28 (GT)13 CTCTTGCTTACGCGTGGACT AGAGACAAGAGCGACGAAGC Lmj24 NA
30 (GT)16 CCTTTGCCTTCTCCCTTTTT GAGCTTGGCGTAATCATGGT NA NA
  1. Note: Lmj: Leishmania major, Lmx: L. mexicana, Lin: L. infantum, Ld: L. donovani. NA: not available.