Skip to main content

Advertisement

Table 1 Primers for selected genes analyzed using Q-PCR

From: Genome-wide comparative analysis revealed significant transcriptome changes in mice after Toxoplasma gondii infection

Genes Primer sequence (5’-3’) GenBank number Length of PCR products (bp)
Gnal TGGGCAACAGCAGCAAGA AC140336 131
  AAGCAGCAGGCGGTGAGT   
Itgb1 CTGGTCCCGACATCATCC AC156608 81
  TCCAAATCAGCAGCAAGG   
C3 TGGACCAGACCGAACAGT BC043338 125
  GAAGGCAGCATAGGCAGA   
Nos2 GAGCGAGTTGTGGATTGTC AL592185 133
  CCAGGAAGTAGGTGAGGG   
Fgfr2 TCAGCTGGGGGCGCTTCATC AC157606 158
  GGGGGCAACCACGTACGCTTC   
Fos AGACCGTGTCAGGAGGCA BC029814 111
  CCATCTTATTCCGTTCCCT   
Erbb4 ATGGCAGGTGCTATGGAC AC167658 168
  GAAAGGTGGTTGGATTGT   
Stat5b TGCTCATCAACAAGCCAGAC AL591466 121
  AAAGGCATCAGATTCCAAA   
Igf1r CCTTTGGGATGGTCTATGA AC101879 88
  GCCTCGTTTACCGTCTTG   
Rac2 TGATGGTGGACAGTAAGCC AL590144 122
  TAGCGAGAAGCAGATGAGAA   
Itgb2 TCGGCTTTGGGTCGTTTG AC153830 151
  TGGTTGGAGTTGTCGGTTA   
Kdr GCAAATACAACCCTTCA BC020530 95
  ACCAATACCCTTTCCTCA   
Cblb GCTCGGCTACAGAAATAC AK147367 167
  TCCCTGCTACCATCAATC   
Cd4 ACTCACCCTCAAGATACCC AC142254 119
  GAGCCACTTTCATCACCA   
Cd8a ATTGGACTTCGCCTGTG AC160090 109
  CTTTCGGCTCCTGTGGT   
Jun ACGCCAACCTCAGCAACTTC AK159196 193
  GTCTGCGGCTCTTCCTTC   
TNF GTGGAACTGGCAGAAGAGG CR974444 94
  CAAGCAGGAATGAGAAGAGG   
Mapk3 CGGATTGCTGACCCTGA BC029712 111
  GGATTTGGTGTAGCCCTTG   
Ep300 CCAAGCATAGGGAATCAA AC102262 184
  GGTCAGCAGAAGGAGCAG   
Prkca AGTGCCAAGTTTGCTGTT AL645535 143
  GGTAGGGCTTCCGTATGT   
GAPDH AGGTCGGTGTGAACGGATTTG BC082592 123
  TGTAGACCATGTAGTTGAGGTCA   
β-actin CGTGAAAAGATGACCCAG AC144818 167
  AGAGCATAGCCCTCGTAGA