Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 List of microsatellite markers used in the study with details of the primer sequences

From: Analysis of population genetic structure of Indian Anopheles culicifacies species A using microsatellite markers

S. No Microsatellite markers Primer sequence 5′-3′
1 AcA11B5 CGGAAAACGTTGCAACAAAATC
ATCCAACCGTAGCCATAACAAAAC
2 AcA59 GCGTAGGTCAACCGTAATGC
TCCCACATACCGATACACCA
3 AcAVB93 GTCCTTTGCAAATCACATCGG
TTAATGACTTCAATCCACAAACCC
4 AcAVIIB46 AACCGGAAGCAGTATCGCACAC
GAGGCTCCTTCGTTCCATCCG
5 AcAVIB213 ATAAAACGCCCCGCATCATACATG
ACGGCACATTCCCTCCCATAG
6 AcA61 CGAATGCATTTCGCTTGATA
TTCCTACTCACCAGCTGAAC
7 AcAVB93A GTGGCCGTTGTTCGTCCTTTTG
TGCTCGTGGCGTTCGTGAGTC
8 AcAVIIIB40 TCAAGCTGGACAATGTAACTCAAC
   TTCAATCAAACCCAGCCAAAC