Skip to main content

Advertisement

Table 1 DNA sequences of primer and probes

From: Ability to cause erythema migrans differs between Borrelia burgdorferi sensu lato isolates

Oligo name Sequence (5’-3’)
Duplex qPCR  
OspA_F AATATTTATTGGGAATAGGTCTAA
OspA_R CTTTGTCTTTTTCTTTRCTTACAAG
FlaB-F CAGAIAGAGGTTCTATACAIATTGAIATAGA
FlaB-Rc/t GTGCATTTGGTTAIATTGYGC
OspA_probe FAM-AAGCAAAATGTTAGCAGCCTTGA-BHQ-1™
FlaB-probe JOE-CAACTIACAGAIGAAAXTAAIAGAATTGCTGCTGAICA
IGS PCR  
5S GAGTTCGCGGGAGAGTAGGTTATTGCC
23S TCAGGGTACTTAGATGGTTCACTTCC
OspC PCR  
OC6 AAAGAATACATTAAGTGCGATATT
OC602 GGGCTTGTAAGCTCTTTAACTG
  1. FAM: 6-carboxyfluorescein; JOE: -carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein.