Skip to main content

Table 1 Known and novel microRNAs (miRNAs) identified from the pancreatic fluke Eurytrema pancreaticum

From: Identification and characterization of microRNAs in the pancreatic fluke Eurytrema pancreaticum

Name Location at genomea mfeb Countc locationd Sequencee
Known miRNA
sja-bantamf SJC_S000254:283545:283639:+ −27.5 3488 3p TGAGATCGCGATTAAAGCTGG
sja-let-7 SJC_S005824:19533:19622:+ −33.1 50 5p GGAGGTAGTTCGTTGTGTGGT
sja-miR-2a SJC_S000054:242652:242727:- −34.2 4406 3p TCACAGCCAGTATTGATGAAC
sja-miR-2b SJC_S000054:242557:242635:- −33.6 500 3p TATCACAGCCCTGCTTGGGACAC
sja-miR-2c SJC_S000102:360645:360725:+ −28.42 62 3p TATCACAGCCGTGCTTAAGGGC
sja-miR-2d SJC_S000102:360534:360627:+ −33.1 727 3p TATCACAGTCCTGCTTAGGTGACG
sja-miR-2e SJC_S000054:242457:242536:- −24.7 1721 3p TATCACAGTCCAAGCTTTGG
sja-miR-71 SJC_S000054:242738:242817:- −33.01 19048 5p TGAAAGACGATGGTAGTGAGA
sja-miR-71b SJC_S000102:360305:360397:+ −36.2 144949 5p TGAAAGACTTGAGTAGTGAGACGC
sja-miR-124 SJC_S000254:113694:113791:+ −29.8 32 3p TAAGGCACGCGGTGAATGTCA
sja-miR-8 SJC_S001790:88898:88974:+ −31.5 12 3p TAATACTGTTAGGTAAAGATGC
sja-miR-2162 SJC_S000471:21744:21822:- −37.9 13 3p TATTATGCAACGTTTCACTCT
sja-miR-10g SJC_S000052:310019:310093:+ −23.4 2698/11 5p/3p AACCCTGTAGACCCGAGTTTG/AAATTCGAGTCTATAAGGA
Novel miRNA
Epa-miR-01 SJC_S000054:242558:242634:- −31.1 97 3p TATCACAGCCCTGCTTGGGACA
Epa-miR-02 SJC_S000057:543062:543147:- −20.4 7 5p AGAAGGCTGCGTGTTCGGATC
Epa-miR-03 SJC_S000065:176156:176237:+ −22 7 5p CTGTCTTCTCTCTCATGTTC
Epa-miR-04 SJC_S000083:92590:92686:+ −27.7 16 3p GTTTGAGACTCCGAATGATG
Epa-miR-05 SJC_S000102:360305:360397:+ −36.2 151 5p TGAAAGACTTGAGTAGTGAG
Epa-miR-06 SJC_S000102:360535:360626:+ −33.1 111 3p TATCACAGTCCTGCTTAGGTGAC
Epa-miR-07 SJC_S000102:360645:360725:+ −28.42 62 3p TATCACAGCCGTGCTTAAGGGC
Epa-miR-08 SJC_S000115:155214:155289:- −18.2 138 3p GCTATCTCGTCGATACTGGC
Epa-miR-09 SJC_S000254:113694:113791:+ −29.8 32 3p TAAGGCACGCGGTGAATGTCA
Epa-miR-10 SJC_S000254:283542:283641:+ −30.7 176 3p TGAGATCGCGATTAAAGCTGGTT
Epa-miR-11 SJC_S000471:21744:21822:- −37.9 13 3p TATTATGCAACGTTTCACTCT
Epa-miR-12 SJC_S001790:88898:88974:+ −31.5 12 3p TAATACTGTTAGGTAAAGATGC
Epa-miR-13 SJC_S005824:19533:19622:+ −33.1 50 5p GGAGGTAGTTCGTTGTGTGGT
Epa-miR-14g SJC_S008424:1:71:+ −30.1 33/8 5p/3p GACGGGGTGGCCGAGTGGTT/CCATTGGGGTTTCCCCGCGT
  1. Note: a location of mature miRNAs at the reference genome of Schistosoma japonicum; b energy of stem-loop structure of miRNA precursors, with unit as Kcal/mol; c sequencing count; d location of a mature miRNA at the 3p or 5p arm of its precursor; e sequence of mature miRNA; f Known miRNAs matched perfectly with that from S. japonicum deposited in the miRBase database; g the only two miRNAs (miR-10, Epa-miR-14) that had mature miRNAs both detected at the 5p and 3p arms of their precursors in the E. pancreaticum. Blue: the largest family members of miR-2.