Skip to main content

Table 1 Primers used for multiplex PCR and nested PCR

From: The Anopheles community and the role of Anopheles minimus on malaria transmission on the China-Myanmar border

Species Primer name Sequences (5′ to 3′) Amplification size (bp) Sources
Forward primer for Anopheles ANF ATCACTCGGCTCATGGATCG   Phuc et al. (2003)
An. minimus MAR GGGCGCCATGTAGTTAGAGTTG 184  
An. harrisoni MCR GGTTGCCCACTCAATACGGGTG 509  
Reverse primer for animal UNR GGTTGTCCTCCAATTCATGTTA   Kent et al. (2005)
 Human HUF GGCTTACTTCTCTTCATTCTCTCCT 335  
 Cow COF CATCGGCACAAATTTAGTCG 561  
 Pig PIF CCTCGCAGCCGTACATCTC 453  
 Dog DOF GGAATTGTACTATTATTCGCAACCAT 680  
P. falciparum PFF TTAAACTGGTTTGGGAAAACCAAATATATT 205 Snounou et al. (1993)
  PFR ACACAATGAACTCAATCATGACTACCCGTC   
P. vivax PVF CGCTTCTAGCTTAATCCACATAACTGATAC 121  
  PVR ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA