Skip to main content

Table 1 Nucleotide sequences of PCR primers and probes

From: A system to simultaneously detect tick-borne pathogens based on the variability of the 16S ribosomal genes

Oligonucleotide Sequence (5′-3′) Target bacteria Source
DNA microarray amplification   
16S27f GAGAGTTTGATCCTGGCTCAG Almost all eubacteria Modified oligo fD1[38]
16S1495r CTACGGCTACCTTGTTACGA Almost all eubacteria Modified oligo fD1[38]
qPCR amplification    
CbqPCR F GGGAAACTCGGGCTAATACC Coxiella spp. This study
CbqPCR R CACGAGGTCCGAAGATCC Coxiella spp. This study
CbqPCR P FAM-CCCGCTTTGCTCCAAAGAGATTATG-TAMRA Coxiella spp. This study
RcqPCR F GCTTAACCTCGGAATTGCTT Rickettsia spp. This study
RcqPCR R CGTCAGTTGTAGCCCAGATG Rickettsia spp. This study
RcqPCR P HEX-CCTTCGCCACCGGTGTTCCT-TAMRA Rickettsia spp. This study
FrqPCR F ATTAAAGGTGGCCTTTGTGC Francisella spp. This study
FrqPCR F2 ATTAAAGGTGGCTTTCGGGC Francisella spp. This study
FrqPCR R ACCAACTAGCTAATCCAACGC Francisella spp. This study
FrqPCR P Cy5-AGGCTCATCCATCTGCGGCA-BHQ2 Francisella spp. This study
Capture probes    
A3 CGGCTATCTGGTCCGGTACTGAC Anaplasma spp. [28]
Av GCTGAATGTGGGGATTTTTTATCTCTGT Anaplasma spp. [28]
Be AAGGGTGGAATCTGTTGATATCAGG Borrelia spp. [28]
Bg1 CTGGTGTAAGGGTGGAATCTGTTGA Borrelia spp. [28]
Bg2 TCAGAAAGAATACCGGAGGCGAAGG Borrelia spp. This study
Bsp1 GGAATAAGCTTTGTAGGAAATGGCAAAGTGATGACG Borrelia spp. This study
Bv ACTTGGTGTTAACTAAAAGTTAGTACCGA Borrelia spp. [28]
Bv2 TATCAGGAAGAATACCGGAGGCGAA Borrelia spp. This study
C1 AATATCCTTGGGCGTTGACGTTACC Coxiella spp. [28]
Cv ACTAGCTGTTGGGAAGTTCACTTCTTAGT Coxiella spp. [28]
F1v ACTAGCTGTTGGAGTCGGTGTAAAGG Francisella spp. [28]
F2 TAGAGGAATGGGGAATTTCTGGTGT Francisella spp. [28]
F2v ACTAGCTGTTGGATTCGGTGTAAAGG Francisella spp. [28]
Fa AATAGCCTTGGGGGAGGACGTTAC Francisella spp. [28]
NM CTATTTAAACTAGAGATCGAGAGAGGATAGTGG C. Neoehrlichia mikurensis This study
R1 TAGAGTRTAGTAGGGGATGATGGAA Rickettsia spp. [28]
Rv GCTAGATATCGGAAGATTCTCTTTCGG Rickettsia spp. [28]
Re GTGGTCGCGGATCGCAGAGA Rickettsia spp. [28]