Skip to main content

Table 1 Primers used in qPCR

From: Host serum miR-223 is a potential new biomarker for Schistosoma japonicum infection and the response to chemotherapy

Gene Primer sequence (5'-3')
mmu-miR-223 Forward ATGGTTCGTGGG TGTCAGTTTGTCAAAT
  Reverse GCAGGGTCCGAGGTATTC
mmu-miR-146b Forward ATGGTTCGTGGGTGAGAACTGAATTCCA
  Reverse GCAGGGTCCGAGGTATTC
mmu-miR-199a-5p Forward ATGGTTCGTGGGCCCAGTGTTCAGACTAC
  Reverse GCAGGGTCCGAGGTATTC
mmu-miR-199a-3p Forward ATGGTTCGTGGGACAGTAGTCTGCACAT
  Reverse GCAGGGTCCGAGGTATTC
mmu-miR-122 Forward ATGGTTCGTGGGTGGAGTGTGACAATGG
  Reverse GCAGGGTCCGAGGTATTC
mmu-miR-34a Forward ATGGTTCGTGGGTGGCAGTGTCTTAGCT
  Reverse GCAGGGTCCGAGGTATTC
cel-miR-39 Forward ATGGTTCGTGGGTCACCGGGTGTAAATC
  Reverse GCAGGGTCCGAGGTATTC
U6 Forward GCTTCGGCAGCACATATACTAAAAT
  Reverse CGCTTCACGAATTTGCGTGTCAT