Skip to main content

Table 1 Oligonucleotide probes used in the Luminex suspension array for the detection and species identification of ovine piroplasms

From: Assessment of exposure to piroplasms in sheep grazing in communal mountain pastures by using a multiplex DNA bead-based suspension array

Probe Sequence (5’- 3’) Size (bp) nmol References
Catch-all TB TAATGGTTAATAGGA(A/G)C(A/G)GTTG 22 1 [11]
Babesia ovis CGCGGCCTTTGCGTTACTTT 20 0.5 This work
Babesia motasi TCCGTTATTGGAGTATTGCG 20 0.5 This work
Theileria ovis TTTTGCTCCTTTACGAGTCTTTGC 24 0.5 [1]
Theileria luwenshuni/OT1 ATCTTCTTTTTGATGAGTTGGTGT 24 0.5 [1]
Theileria sp. OT3 ATTTTCTCTTTTTATATGAGTTTT 23 0.5 [1]
Theileria annulata / lestoquardi GGGTCTGTGCATGTGGCTTTT 20 0.5 [8]
IAC GCATCGGTTACAAGAACGCA 20 0.5 [8]
  1. Catch-all TB, Theileria-Babesia conserved probe; IAC, internal amplification control.