Skip to main content

Table 2 Details for 15 polymorphic microsatellite loci developed for Schistosoma haematobium

From: Significant variance in genetic diversity among populations of Schistosoma haematobium detected using microsatellite DNA loci from a genome-wide database

Locus Primer Sequence 5′ -- > 3′ Repeat motif TA Size (bp) N k
Shae_01 F: †GCATCCAATTTCGTACAC AAT TD60 257 - 307 65 12
  R: *CCACATTAGGCCAACAAG      
Shae_02 F: *TTAGTGTGTTTGGCTTCAAC AAT TD60 183 – 225 69 9
  R: †CCTCGAATGAAATCCTGAC      
Shae_03 F: †GCTGAGCTTGAGATTG AAT TD55 291 – 334 62 15
  R: *CTTCTGTCCCATCGATACC      
Shae_04 F: †CCCATCGCTGATATTAAAG AAT TD65 289 – 325 70 10
  R: *TCTAGTCGTCTTGGGATCC      
Shae_05 F: *TGTGCACAAGAAAGATTAAATG AAT TD65 288 – 319 68 10
  R: †ACGACAATGTTGCAAGTTC      
Shae_06 F: †GGTGGATTACGCAATAG AC TD65 333 – 347 67 8
  R: *TTTAATCAACCGGGTGTC      
Shae_07 F: *TCCAAGCACCATTATCAAG AAT TD65 315 – 330 66 6
  R: †ACGGAAACTTGTTGAAATG      
Shae_08 F: *CTAAACTGGCAAGATTTC AAT TD65 299 – 330 68 11
  R: †CAACGTGCCTTTATTTC      
Shae_09 F: †GGGATGTATGCAGACTTG AAT TD65 213 – 256 68 13
  R: *TTGTTTGGCTGCAGTAAC      
Shae_10 F: †CGCATGTCATACCTATCTCC AAT TD65 198 – 213 69 6
  R: *GCTTATCAGGCCTATCTCC      
Shae_11 F: *TTGGTTTAGAAATTACATCACC ATC TD65 207 – 222 66 5
  R: †CCAACAATATTAATGGACAGC      
Shae_12 F: †CGTCTTAGTGAGCCAGATG AAC TD65 257 – 278 68 6
  R: *CTCGTGGACATCATCAG      
Shae_13 F: *GAGCAGCTATTTCGTATCG AAT TD60 183 – 225 69 12
  R: †ACCGTGGACAGTTCATCAG      
Shae_14 F: *GTCCTCCTTCCCTCTTTG ACTC TD65 210 – 254 67 10
  R: †CACATTCGTCCTAGATATCG      
Shae_15 F: *CTTTCAGTAGGATTTGTTG ATC TD65 300 – 322 67 9
  R: †CGACGTCAAGCACTGTAC      
  1. * indicates CAG tag (5′- CAGTCGGGCGTCATCA-3′).
  2. † indicates pigtail (5′- GTTT-3′).
  3. The annealing temperature (T A ) where TD65, TD60, and TD55 indicates touchdown protocols with a highest annealing temperature of 65°C, 60°C, and 55°C, respectively; size indicates the range of sequenced alleles in base pairs plus the length of the CAG tag; the number of individuals genotyped out of 72 is N; k is the number of alleles observed.