Skip to main content

Table 1 Oligonucleotide primers used for PCR amplification and sequencing

From: Microbial communities and symbionts in the hard tick Haemaphysalis longicornis (Acari: Ixodidae) from north China

Primer name Genera or Species Target gene Nucleotide sequence (5′-3′) Annealing temperature (°C) Approx product size (bp) Reference
CLS F Coxiella 16S rRNA CACGTAGGAATCTACCTTGTAG 55 90 55
CLS R    CGTTTTGTTCCGAAGAAATTAT    
ALS 82 F Arsenophonu 16S rRNA AGGGAGCTTGCTTCCTGGCCGG 59 130 55
ALS 198R    CGAAGGTGTGAGGCCTAATGG    
Rickettsia 354 F Rickettsia 16S rRNA CAGCAATACCGAGTGAGTGATGAAG 56 350 69
Rickettsia 647R    AGCGTCAGTTGTAGCCCAGATG    
NCLS F NCLS 16S rRNA TCCCTGGCGGCGAGTGG 55 110 This study
NCLS R    CGTATTAGAGATTAGAGAAACC    
Rr 190.70p Rickettsia rompA ATGGCGAATATTTCTCCAAAA 48 540 57
Rr 190.602n    GTTCCGTTAATGGCAGCATCT