Skip to main content

Advertisement

Table 1 Sequences of primers used to amplify PCR fragments from Spirocerca lupi

From: Characterization of the complete mitochondrial genome of Spirocerca lupi: sequence, gene organization and phylogenetic implications

Name of primer Sequence (5’ to 3’)
Short-PCR  
For cox 1  
JB3 TTTTTTGGGCATCCTGAGGTTTAT
JB4.5 TAAAGAAAGAACATAATGAAAATG
For cox 2  
SLCO2F TTGAAATTACGAGTATGGGGATA
SLCO2R AGCTCCACAAATTTCTGAACACT
For nad 2  
SLND2F TGGTGGAGGGGTTTTGTTATTTG
SLND2R ATCTTCTCAACCTGACGACC
For rrn S  
SL12SF AATCAAAATTTATTAGTTCGGGAGT
SL12SR AATTACTTTTTTTTCCAACTTCAA
Long-PCR  
SLCO1F CTTTAGGTGGTTTGAGAGGTATTGTT
SL12S R CTTCATAAACCAAATATCTATCTGT
SL12SF ATAGATATTTGGTTTATGAAGATTT
SLCO2R AAGAATGAATAACATCCGAAGAAGT
SLCO2F CCTATTGTTGGCTTATTTTATGGTCAG
SLND2R CAAAAATGAAAAGGTGCCGAACCAGAT
SLND2F GGTTTTGGTCGTCAGGTTGAGAAGA
SLCO1R ATCATAGTAGCCGCCCTAAAATAAGTA