Skip to main content

Table 1 PCR primers and conditions

From: LUMINEX®: a new technology for the simultaneous identification of five Entamoeba spp. commonly found in human stools

Generic PCR Primers (5′ -3′) Cycling structure
JVF (forward) GTTGATCCTGCCAGTATTATATG 95°C for 5 min followed by 40 cycles of 95°C for 30 s, 57°C for 30 s, 72 C for 1 min, 72 C for 7 min
JVF (forward) GTTGATCCTGCCAGTATTATATG 95°C for 5 min followed by 40 cycles of 95°C for 30 s, 50°C for 30 s, 72 C for 1 min, 72 C for 7 min
EntaRev 390* (reverse) ATTCCTCGTTATCCGTTAT
JVF (forward) GTTGATCCTGCCAGTATTATATG 95°C for 5 min followed by 40 cycles of 95°C for 30 s, 55°C for 30 s, 72 C for 1 min, 72 C for 7 min
EntaRev417* (reverse) AAAGCTCCTCTCCGATGT
  1. *tagged with biotin at the 3′.