Skip to main content

Table 2 List of probes used in this study

From: LUMINEX®: a new technology for the simultaneous identification of five Entamoeba spp. commonly found in human stools

Specificiy(ies) Probes Probe sequence (5′ – 3′) Length (nt)
E. histolytica Hist 1 TAGTACAAAATGGCCAATT 19
E.histolytica Hist 116 GGTTAGTAAAATACAAGG 18
E. histolytica Hist 168 CGATCCAGTTTGTATTAGT 19
E. histolytica Hist 200 TATTAGTACAAAATGGCCAAT 21
E. histolytica Hist 242 AATGAATTGAGAAATGACAT 20
E. moshkovskii Emosh 1 AGACGATCCGGTTTGTAT 18
E. moshkovskii Emosh 2 TAAATACTCTTACGAAATC 19
E. hartmanni Ehart 1 ATGAGAATATCTGATCTA 18
E. hartmanni Ehart 123 ATTAGTAAGTACAAGGAT 18
E.histolytica and E. dispar Hist/Disp 275 TTAGGATGCCACGACAATT 19
E. hist, E. disp, E. coli, E. hart, E. mosh EGP 1 TACAGGATAGCTTTGTGAAT 20
E. hist, E. disp, E. coli, E. hart, E. mosh EGP 2 TGAATGATAAAGATAATACT 20