Skip to main content

Table 1 Primer sequences and amplicon lengths of quantitative real-time PCR products of target genes

From: Changes in the proteomic profiles of mouse brain after infection with cyst-forming Toxoplasma gondii

Target genes Primers (5′ to 3′) Amplicon length (bp)
Rho GDP-dissociation inhibitor 1 FP: AGTCTTGTGACCCCGGAAGT 129
Stomatin-like protein 2 FP: GTCAGCGCATTCTCCAAACT 180
  1. FP: Forward primer; RP: Reverse primer.