Skip to main content

Table 1 Microsatellite markers used in this study

From: Multilocus microsatellite typing reveals a genetic relationship but, also, genetic differences between Indian strains of Leishmania tropica causing cutaneous leishmaniasis and those causing visceral leishmaniasis

m/sat fw primer(5´→3´) rev primer(5´→3´) AT (°C) Fragment size(bp)* Repeat array*
GA1 TCGGAGTCACCTCGCACCGC GGTGGGGCAGGTAAAGCGGC 56 66 (GA)11
GA2 GATCACAGCGACGTCTGAAG CCTGCTGCCACCATCTTAAGC 56 62 (GA)8
GA6 GTGTGAGCTAATCGATTGGG CGCTCTCTCTGTCTCTGTCT 42 61 (GA)8
GA9n CAAGTCCAAATCAGAAGAGC CTCTATCCACTGCGTTTCTC 60 112 (GA)7
LIST7010 CGGTGAATGCCTAAAGAGAGA AGGAACGCATACTTGGAAGG 42 190 (TA)28
LIST7011 CGGCGACATGCACACATA CACACACATTGAAGATGGAGGA 42 186 (TA)15
LIST7027 CTCTCTCGTCACCACAGCAC AGGGGACAAGACACAGATGG 50 181 (CA)12
LIST7033 CATTGCTGAGTGCTGCTAGTG ATGAGCGTACTGGGCACAC 44 180 (GT)8
LIST7039 CTCGCACTCTTTCGCTCTTT GAGACGAGAGGAACGGAAAA 44 205 (CA)16
LIST7040 GCAGAGCGAGACACACAGAC GTGCACGTTGATGTGCTTCT 50 245 (GT)23
4GTG CGGTTTGGCGCTGAAAGCGG CGTGAGGACGCCACCGAGGC 58 62 (GTG)5
27GTGn GATAGCGTTGGAGGCAAGC CTATCCGCACCACGATCC 60 106 (GTG)5
  1. AT, annealing temperatures in °C; *, fragment sizes and repeat arrays as in the reference strain MHOM/PS/2001/ISL590.