Skip to main content

Advertisement

Table 1 Sequences of primers used to amplify mt DNA regions from Fasciola spp.

From: Complete mitochondrial genomes of the ‘intermediate form’ of Fasciola and Fasciola gigantica, and their comparison with F. hepatica

Primer Sequence (5’ to 3’)
F. gigantica  
FGCF1 TGTTTACTATTGGTGGGGTTACTGGT
FGNR1 CAAACCCTACAGAACTATCCCTCCAA
FGNF1 GTTATGGGATTCAGTCTTGGAGGGAT
FGCR1 CGTATCCAAAAGAGAAGCAGAAAGCA
Fasciola sp.  
FZCF1 GGGTTACTGGTATTATGCTTTCTGCT
FZNR1 CCCTACAGAACTATCCCTCCAAGACT
FZNF1 GGTGGTATTATGGGCAGTTATGGGAT
FZCR1 CAGAAAGCATAATACCAGTAACCCCA