Skip to main content

Table 1 Oligonucleotides for qPCR

From: Global transcriptional analysis reveals surface remodeling of Anaplasma marginale in the tick vector

Name Sequence (5′-3′) Target gene
AM008 F ATGCAGCAGCGTGGAGAAGCT AM008
AM008 R AAGCTGGTCCTGTGTGGTTGTTACGT  
AM009 F AAGGGACGGCGAAGTCACAGC AM009
AM009 R TACTTGGACCTCAGGGTACATTTGGCT  
AM360 F TTGACTTACTCGCTGGTATCGCCTACAA AM360
AM360 R AAGAGTACCCAAGTATGCCAAAACCCGA  
AM366 F TATGGCGAGGAAGGCGTTCAAAGTC AM366
AM366 R TGCGAAGCACCGTACATGACGATT  
AM779 F AGGACCACAACCCCATCATGTTTGT AM779
AM779 R TTCCCTAGAGCAGAGGTCTAGTGAGT  
Msp3 F1 (2281) AACCCAACTTTCAACGGTATCAAGGACCT msp3
Msp3 R1 (2528) ATCCCTACTTCAACCCTGGCTCCT  
Msp1b F (229) TACGAGAGCGTGGGACTACGTGCTA msp1b
Msp1b R (439) AAGCTGCTGCCTTGCCAAATTCTTG  
New msp5 F AAGTTGTAAGTGAGGGCATAGCCTCC msp5
New msp5 R AACTTATCGGCATGGTCGCCTAGT  
Omp4 F TTCCAACACACAGGAGGTGACACAC omp4
Omp4 R TTCTCTGCACCATAGCCCGCAA  
Omp8 F TTGCCCGAGCACCGAGATTTCT omp8
Omp8 R ATGGCTTTGCGTCTCCGTTCAG  
virB10 F ATCGTGGACGTAAGGACATTCCCCA virB10
virB10 R TGACTGTGAGTTGGTCTAGGGTCATCC