Skip to main content

Table 1 Sequences of the oligonucleotide primers used in this study

From: Molecular identification of Theileria parasites of northwestern Chinese Cervidae

Pathogen Target gene Oligonucleotide sequences (5′-3′) Final amplicon size (bp) Reference
Forward Reverse
Hemoparasite 18S rRNA AACCTGGTTGATCCTGCCAGT GATCCTTCTGCAGGTTCACCTAC 1750 Medlin et al., [20]
Theileria spp. 18S rRNA AGTTTCTGACCTATCAG TTGCCTTAAACTTCCTTG 1098 Allosop et al., [21]
T. annulata 30 kDa GTAACCTTTAAAAACGT GTTACGAACATGGGTTT 721 d’Oliveria et al., [22]
T. sergenti MPSP CACGCTATGTTGTCCAAGAG TGTGAGACTCAATGCGCCTA 875 Liu et al., [23]
T. sinensis MPSP CACTGCTATGTTGTCCAAGAGATATT AATGCGCCTAAAGATAGTAGAAAAC 887 Liu et al., [23]
T. orientalis MPSP CTTTGCCTAGGATACTTCCT ACGGCAAGTGGTGAGAACT 776 Ota et al., [24]
T. cervi (Type F) 18S rRNA TTCCCTTTGAGGGGT AAGCCTATTCCCGTACC 654 Boes et al., [25]
T. cervi (Type G) 18S rRNA CTTCCCGTTATGGAGG CTTAACCTATTCCCGTGAG 654 Boes et al., [25]
T. luwenshuni 18S rRNA GGTAGGGTATTGGCCTACTGA TCATCCGGATAATACAAGT 340 Yin et al., [26]
T. uilenbergi 18S rRNA GGTAGGGTATTGGCCTACCGG ACACTCGGA AAATGCAAGCA 340 Yin et al., [26]
T. ovis 18S rRNA TCGA-GACCTTCGGGT TCCGGACATTGTAAAACAAA 520 Altay et al., [27]
T. lestoquardi 18S rRNA GTGCCGCAAGTGAGTCA GGACTGATGAGAAGACGATGAG 785 Aktas et al., [28]
T. capreoli 18S rRNA gtcttgtaattggaatgatgg ccaaagactttgatttctctc 580 Slemenda et al., [29]
Babesia spp. 18S rRNA TGTCTTGAATACTT(C/G)AGCATGGAA CGACTTCTCCTTTAAGTGATAAC 950 Ramos et al., [10]
B. odocoilei 18S rRNA CACCGTATTTTGACTTTTTGTCGACTGTCGG CCCGTAACGGACGAACCTTCTCACGGG 900 Ramos et al., [10]
B. bovis 18S rRNA CTGTCGTACCGTTGGTTGAC CGCACGGACGGAGACCGA 541 Guido et al., [30]
B. ovata AMA-1 GATACGAGGCTGTCGGTAGC AGTATAGGTGAGCATCAGTG 504 Sivakumar et al., [31]
B. bigemina 18S rRNA TGGCGGCGTTTATTAGTTCG CCACGCTTGAAGCACAGGA 1124 Guido et al., [30]
B. ovis 18S rRNA TGGGCAGGACCTTGGTTCTTCT CCGCGTAGCGCCGGCTAAATA 549 Aktas et al., [32]
B. motasi 18S rRNA AAGAATTTCACCTCTGACAG GCTTGCTTTTTGTTACTTTG 179 Shayan et al., [33]