Skip to main content

Table 1 Loop-mediated isothermal amplification (LAMP) primers based on Wolbachia 16S sequences, designed using LAMP designer 1.02 software

From: Wolbachia detection in insects through LAMP: loop mediated isothermal amplification

Primer Sequence (5′-3′)
F3 CTCGTGTCGTGAGATGTTG
B3 GAACGTATTCACCGTGGC
FIP CCCACTCCATAAGGGCCATGAGGGACTTTAAGGAAACTGCC
BIP CAATGGTGGCTACAATGGGCTGGCAGAGTACAATCCGAACTG
LoopF CCACCTTCCTCCAGTTTATCAC
LoopB CGCGAGGCTAAGCTAATCC