Skip to main content

Table 1 List of primers used in the present study

From: Humoral responses in Rhodnius prolixus: bacterial feeding induces differential patterns of antibacterial activity and enhances mRNA levels of antimicrobial peptides in the midgut

Gene/name Sequence 5’-3’ Tm (°C) Amplicon length
RPDEFAF GAATACTCCACTCAACCGCAAC 62.7  
RPDEFAR TAGTTCCTTTACATCGGCCA 58.4 295 bp
RPDEFBF CAGTACCTAGGATATTCCACTCAAC 62.9  
RPDEFBR TAGTTCCTTTACAATGGCCG 58.4 304 bp
RPDEFCF CAGTACAGTCCTAATACCTAGCC 62.8  
RPDEFCR CAGTTCCTACGCAACGGCCT 64.5 300 bp
RPLYS1F TTCTTACTGGCTATTTTCGCC 58.7  
RPLYS1R CGACCTCTGCAATGGTACTG 62.4 377 bp
RPLYS2F CTAGTTTTAACACTATTGCTGCTG 59.4  
RPLYS2R GCCCTTACATTTCTTGATCC 58.4 378 bp
RPPROLF CTATAACGAGTGAACTATAAGACAA 50.0  
RPPROLR GTGTTTAATGGCGGTAACAAATTAC 53.2 406 bp
RPACTF CACGAGGCTGTATACAATTCCA 60.8  
RPACTR GTAGCTGTTTAGAAGCATTTGCG 61.0 314 bp