Skip to main content

Table 1 Target genes, primers sequence, PCR methods used for pathogens identification

From: Tick-borne pathogens and associated co-infections in ticks collected from domestic animals in central China

Pathogens Method Target gene Primers sequence (5′-3′) Product size (bp) Reference
Babesia/Theileria Nested PCR 18S rRNA RIB-19(CGGGATCCAACCTGGTTGATCCTGC) 1700 [28]
RIB-20(CCGAATTCCTTGTTACGACTTCTC)
BAB-F(ACCTCACCAGGTCCAGACAG) 430
BAB-R(GTACAAAGGGCAGGGACGTA)
Anaplasma/Ehrlichia Nested PCR 16S rRNA Eh-out1 (TTGAGAGTTTGATCCTGGCTCAGAACG) 653 [29]
Eh-out2 (CACCTCTACACTAGGAATTCCGCTATC)
Eh-gs1 (GTAATACTGTATAATCCCTG) 282  
Eh-gs2 (TATAGGTACCGTCATTATCTTCCCTAC)
TBEV Nested PCR Non-structural protein NS5 FSM1 (GAGGCTGAACAACTGCACGA) 357 [32]
FSM2 (GAACACGTCCATTCCTGATCT)
FSM1i (ACGGAACGTGACAAGGCTAG) 251
FSM2i (GCTTGTTACCATCTTTGGAG)
Rickettsia spp. Nested PCR groEL Gro1 (AAGAAGGCGTGATAAC) 200 [30]
Gro2 (ACTTCCGTAGCACC)
SF (GATAGAAGAAAAGCAATGATG) 250
SR (CAGCTATTTGAGATTTAATTTG)
B. burgdorferi s. l. Nested PCR Flagellin Outer1 (CTGCTGGCATGGGAGTTTCT) 730 [31]
Outer2 (TCAATTGCATACTCAGTACT)
Inner1 (AAGGAATTGGCAGTTCAATC ) 290
Inner2 (ACAGCAATAGCTTCATCTTG )
Leishmania infantum PCR kDNA RV1(CTTTTCTGGTCCCGCGGGTAGG) 183 [27]
    RV2(CCACCTGGCCTATTTTACACCA)