Skip to main content

Table 2 Primer sequences

From: Distribution and dissemination of the Val1016Ile and Phe1534Cys Kdr mutations in Aedes aegypti Brazilian natural populations

Primer name Sequence (5′ - 3′) References
1016 Val+ (for) ##ACAAATTGTTTCCCACCCGCACC GG [12, 15]
short 5'-tail GCGGGC  
  1. +wild-type specific primer, kdrkdr specific primer, #short 5′tail attached, ##long 5′tail attached.