Skip to main content

Advertisement

Table 2 Primer sequences

From: Distribution and dissemination of the Val1016Ile and Phe1534Cys Kdr mutations in Aedes aegypti Brazilian natural populations

Primer name Sequence (5′ - 3′) References
1016 Val+ (for) ##ACAAATTGTTTCCCACCCGCACC GG [12, 15]
1016 Ilekdr (for) #ACAAATTGTTTCCCACCCGCACT GA
1016 comom (rev) GGATGAACCGAAATTGGACAAAAGC
1534 Phe+ (for) #TCTACTTTGTGTTCTTCATCATA TT [22]
1534 Cyskdr (for) ##TCTACTTTGTGTTCTTCATCATG TG
1534 comom (rev) TCTGCTCGTTGAAGTTGTCGAT
AaEx31P (for) TCGCGGGAGGTAAGTTATTG [14]
AaEx31Q (rev) GTTGATGTGCGATGGAAATG  
long 5'-tail GCGGGCAGGGCGGCGGGGGCGGGGCC  
short 5'-tail GCGGGC  
  1. +wild-type specific primer, kdrkdr specific primer, #short 5′tail attached, ##long 5′tail attached.