Skip to main content

Advertisement

Table 1 Primers used in this study

From: Molecular characterization of Clonorchis sinensis secretory myoglobin: Delineating its role in anti-oxidative survival

Primer Sequence (5′ → 3′)
Generation of recombinant Cs Mb protein
Cs Mb-F AGAGGATCCATGGCACCCCTATCAA
Cs Mb-R CGTCTCGAGTTAGCCAAGAAAGCCG
Preparation of mutant CsMb proteins
Cs Mb-Y34A-F GAATTTGGAAAAGCAGTCGCCATGGCTCTGTTCTCAG
Cs Mb-Y34A-R CTGAGAACAGAGCCATGGCGACTGCTTTTCCAAATTC
Cs Mb-Y68A-F GAGGGGATTAAGTACGCCGGCCAGACCTTTGC
Cs Mb-Y68A-R GCAAAGGTCTGGCCGGCGTACTTAATCCCCTC
Detection of CsMb transcripts via RT-PCR
Cs Mb-RT-F GCTGAACCCGTTGGTGAGTA
Cs Mb-RT-R TCACTGGTAGAGATGAAAGGGC
Cs β-actin -RT-F ACCGTGAGAAGATGACGCAGA
Cs β-actin -RT-R GCCAAGTCCAAACGAAGAATT
Mouse specific primers
iNOS-F GCAATATAGGCTCATCCAG
iNOS-R AACTCGCTCCAAGATTCC
Sod1-F ATTACAGGATTAACTGAAGG
Sod1-R CAATGATGGAATGCTCTC
Sod2-F ACAAACCTGAGCCCTAAG
Sod2-R CTCCCAGTTGATTACATTCC
β-actin -F AACCGCGAGAAGATGACCCAGATCATGTTT
β-actin -R AGCAGCCGTGGCCATCTCTTGCTCGAAGTC